We narrowed to 7,712 results for: PAC;
-
Plasmid#58694PurposeExpresses truncated C-terminal SpCas9 domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with N-Terminal Split Cas9 Gyra Intein for full length SpCas9 productionDepositorInsertHumanized C-Terminal S. pyogenes Cas9 with GyrA Csplit Intein
UseAAV and CRISPRTagsGyrA Csplit Intein and NLSExpressionMammalianPromoterCBhAvailable SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-).TagRFP.T-2A-Tau2N4R-WPRE
Plasmid#226380PurposeExpresses tau propagation ORF with no V5 tag on WT 2N4R tauDepositorAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHLS-EF1a-FKBP12-Gag(HIV)
Plasmid#138476PurposeExpresses FKBP12 fused Gag for packaging FRB-SpCas9 into NanoMEDIC particle.DepositorInsertHIV Gag
TagsFRBP12 and Lynn Myristolation siteExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-EFS-SaABE8eV106W-bGH-U6-sgRNA-BsmBI
Plasmid#189924PurposeAAV genome encoding SaABE8eV106W and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installationDepositorInsertSaABE8e V106W
UseAAVMutationSaCas9 D10A, TadA ABE8e V106WPromoterEFSAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PL-5LTR-RGR(DMD#1)-AmCyan-A
Plasmid#138482PurposeExpresses sgRNA targeting human DMD (Dystrophin) for packaging into NanoMEDIC particle.DepositorInsertRibozyme-flanked gRNA and AmCyan
UseCRISPRExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA GASTM-3-RVG-10-Lamp2b-HA
Plasmid#71295PurposeEncodes (N to C): GASTM mutated glycosylation motif, 3 residue spacer, RVG peptide,10 residue spacer, Lamp2b (exosomal membrane protein), 3 residue spacer, HA tag.DepositorInsertLamp2b (LAMP2 Human)
TagsGASTM mutated glycosylation motif, HA, Lamp2 sig…ExpressionMammalianPromoterCMVAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBS10-ribE-dddAI-FLAG
Plasmid#186562PurposeRegulated expression in Firmicutes of the DddA immunity determinant with a C-terminal fusion to a FLAG epitope (DddAI-FLAG)DepositorInsertdddAI
TagsFLAGExpressionBacterialPromoterpSpac(hy)Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-MAVS-Ala271
Plasmid#158631PurposeGateway entry vector for an inducible 3xFLAG-tagged MAVS mutantDepositorInsertMAVS (MAVS Human)
UseGateway entry vectorTags3XFLAGMutationQ271A please see depositor comments belowAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3xFLAG-MAVS-Ala271 hygro
Plasmid#158637PurposeLentiviral expression vector for an inducible 3xFLAG-tagged MAVS mutant constructDepositorAvailable SinceNov. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3xFLAG-MAVS-Gln93,Ala271 hygro
Plasmid#158638PurposeLentiviral expression vector for an inducible 3xFLAG-tagged MAVS mutant constructDepositorAvailable SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-MAVS-Gln93,Ala271
Plasmid#158632PurposeGateway entry vector for an inducible 3xFLAG-tagged MAVS mutantDepositorAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-MAVS-Ala148,Ala271
Plasmid#158633PurposeGateway entry vector for an inducible 3xFLAG-tagged MAVS mutantDepositorAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3xFLAG-MAVS-Ala148,Ala271 hygro
Plasmid#158639PurposeLentiviral expression vector for an inducible 3xFLAG-tagged MAVS mutant constructDepositorAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3xFLAG-MAVS-Ala148 hygro
Plasmid#158636PurposeLentiviral expression vector for an inducible 3xFLAG-tagged MAVS mutant constructDepositorAvailable SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3xFLAG-MAVS-Gln93 hygro
Plasmid#158635PurposeLentiviral expression vector for an inducible 3xFLAG-tagged MAVS mutant constructDepositorAvailable SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Split Cas9 with GyrA intein
Plasmid#58693PurposeExpresses truncated N-terminal SpCas9 domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with C-Terminal Split Cas9 Gyra Intein for full length SpCas9 productionDepositorInsertHumanized N-Terminal S. pyogenes Cas9 with GyrA Nsplit Intein
UseAAV and CRISPRTags3xFlag, GyrA Nsplit Intein, and NLSExpressionMammalianPromoterCBhAvailable SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSDC803_IKZF1_mutant
Plasmid#224113PurposeInsect cell expression vector for IKZF1 mutant for CRBN cryoEM pre-blottingDepositorInsertIKZF1 (IKZF1 Human)
TagsFlag-TEVExpressionInsectMutationResidues 140-196, Q146A and G151NPromoterpolyhedrinAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28.His.3C.86b.Tau2N4R
Plasmid#226399PurposeExpresses his-tagged, 3C-cleavable, 86b (split luciferase fragment)-tagged WT 2N4R tau for recombinant protein production in bacteriaDepositorAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHLS-EF1a-FRB-SpCas9-A
Plasmid#138477PurposeExpresses FRB fused SpCas9 for NanoMEDIC packaging.DepositorInsertSpCas9, human codon optimized
UseCRISPRTags3x HA tag and FRBExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only