We narrowed to 346 results for: Z-ISO
-
Plasmid#193023PurposeAAV vector plasmid expressing enhanced green fluorescent protein (eGFP) under the mouse phosphoglycerate kinase (PGK) promoterDepositorInserteGFP
UseAAVExpressionMammalianPromoterPGKAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
MOS
Plasmid#64120PurposeA modified episomal (EBNA1/oriP) vector expressing human OCT4 and SOX2 genesDepositorAvailable SinceOct. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
MMK
Plasmid#64121Purposea modified episomal (EBNA1/OriP) vector expressing human Myc and KLF4 genesDepositorAvailable SinceOct. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pS148∙CsR
Plasmid#197858PurposeExpresses Streptococcus pyogenes' cas9 and a tailored sgRNA for counterselection in gram-negative bacteriaDepositorInsertgRNA scaffold - Ap/Cb resistance cassette - incP oriT
UseCRISPR and Synthetic BiologyPromoterPEM7Available SinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUCHR-CD5Flag2-P2A-smAID-mClover
Plasmid#110657PurposeLentiviral vector expressing cell surface Flag-tag and monomeric GFP N-terminaly fused with auxin inducible degronDepositorInsertCD5Flag2-P2A-AID-mClover
UseLentiviralPromoterCMVAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUCHR-mClover-smAID-P2A-CD5HA2-bglpA
Plasmid#110655PurposeLentiviral vector expressing cell surface HA-tag and monomeric GFP C-terminaly fused with auxin inducible degronDepositorInsertmClover-AID-P2A-CD5HA2-bglpA
UseLentiviralPromoterCMVAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUCHR-CD5HA2-P2A-smAID-mClover
Plasmid#110658PurposeLentiviral vector expressing cell surface HA-tag and monomeric GFP N-terminaly fused with auxin inducible degronDepositorInsertCD5HA2-P2A-AID-mClover
UseLentiviralPromoterCMVAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUCHR-mClover-smAID-P2A-CD5Flag2-bglpA
Plasmid#110654PurposeLentiviral vector expressing cell surface Flag-tag and monomeric GFP C-terminaly fused with auxin inducible degronDepositorInsertmClover-AID-P2A-CD5Flag2-bglpA
UseLentiviralPromoterCMVAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUCHR-mClover-smAID-P2A-CD5cmyc2-bglpA
Plasmid#110656PurposeLentiviral vector expressing cell surface c-Myc-tag and monomeric GFP C-terminaly fused with auxin inducible degronDepositorInsertmClover-AID-P2A-CD5cmyc2-bglpA
UseLentiviralPromoterCMVAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Sema6a.z-AP-His
Plasmid#72038PurposeExpresses the extracellular region of the Sema6A, isoform z protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
HA-human-BNIP3
Plasmid#100781PurposeMammalian expression of BNIP3DepositorAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHes7-Achilles-Hes7
Plasmid#153528PurposeExpresses fusion protein of Achilles/YFP and mouse Hes7 from mouse Hes7 promoter. The reporter shows oscillatory expression with 2-3 periodicity when expressed in mouse presomitic mesoderm.DepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJet-CMV-CD52-bglpA
Plasmid#89704PurposeHuman CD52 expression plasmid with short polyADepositorAvailable SinceMarch 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHM1 KGA-WT
Plasmid#227837PurposeUsed for microinjection of nematodes for expression of KGA-WTDepositorAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-28a KGA-WT
Plasmid#227846PurposeTo express in E. coli KGA-WTDepositorAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-28a GAC-WT
Plasmid#227845PurposeTo express in E. coli GAC-WTDepositorAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZEN
Plasmid#129113PurposeZ. rouxii episomal vector containing ClonNAT resistanceDepositorTypeEmpty backboneExpressionYeastAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only