We narrowed to 6,409 results for: Gaa
-
Plasmid#201401PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
ExpressionMammalianAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/Col1a1/GFP4_Seq 1.1
Plasmid#201400PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
ExpressionMammalianAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGO186N-KS1
Plasmid#174301PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #1 targeting the wild type polC gene.DepositorInsertspacer expression cassette
ExpressionBacterialAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGO186N-KS2
Plasmid#174302PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #2 targeting the wild type polC gene.DepositorInsertspacer expression cassette
ExpressionBacterialAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJJF144_SECGFP_sg2
Plasmid#163865PurposesgRNA targeting GFP in C. elegans. Backbone: pJJR50.DepositorInsertsgRNA targeting GFP
UseCRISPRExpressionWormPromoterR07E5.16 (U6)Available SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTBL322 GC
Plasmid#126950PurposeTo target a protospacer with GC at the cut site.DepositorInsertspacer against human genome with GC at cut site
ExpressionMammalianPromoterhuman U6Available SinceMay 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_TIMM23_Puro_T2A_BFP2
Plasmid#236731PurposeDual sgRNA targeting TIMM23 expressing BFP with Puromycin selectionDepositorInsertTIMM23 (TIMM23 Human)
UseLentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
HCP4
Plasmid#166106PurposeThis plasmid encodes a Cas9 protein as well as two sgRNAs, one targets the center of Cyr1 and the other targets a non-coding region on chromosome X (location X1)DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP6
Plasmid#166108PurposeThis plasmid encodes a Cas9 protein as well as two sgRNAs, one targets the C-terminus of Cyr1 and the other targets a non-coding region on chromosome X (location X1)DepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
PX458_NCoA2_1
Plasmid#86341PurposeEncodes gRNA for 3' target of human NCoA2DepositorInsertgRNA against NCoA2 (NCOA2 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaAnillin homology domain
Plasmid#187277PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Anillin homology domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaAnillin homology domainPromoterU6, CMVAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g7-5)-PGKpuroBFP-W
Plasmid#211985PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(LIN28A_5-4)-PGKpuroBFP-W
Plasmid#211969PurposeExpress gRNA against LIN28A with puro and BFPDepositorInsertsgRNA targeting LIN28A (LIN28A Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-56
Plasmid#208979PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312868-39312887), 56 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.56 (RPL3 Synthetic, Human)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR TCF7L2 TSS-guide3
Plasmid#118171PurposeCRISPR-mediated repression of TCF7L2. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
ABL1 gRNA (BRDN0001147538)
Plasmid#77735Purpose3rd generation lentiviral gRNA plasmid targeting human ABL1DepositorAvailable SinceJuly 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
NPR2 gRNA (BRDN0001147043)
Plasmid#77754Purpose3rd generation lentiviral gRNA plasmid targeting human NPR2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only