We narrowed to 6,039 results for: pCas
-
Plasmid#210488PurposepDEST vector to tag gene of interest with DHFR F[3] on the N-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pKB11 (pDEST-DHFR F[1,2] C-term, NatR)
Plasmid#210485PurposepDEST vector to tag gene of interest with DHFR F[1,2] on the C-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDN0605 (pDEST-DHFR F[1,2] N-term, NatR)
Plasmid#210487PurposepDEST vector to tag gene of interest with DHFR F[1,2] on the N-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceDec. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC45A3
Plasmid#132167PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC45A3 (SLC45A3 Human)
ExpressionMammalianAvailable SinceDec. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC45A3_STOP
Plasmid#161333PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC45A3 (SLC45A3 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGG431
Plasmid#165615PurposeVector for expression of SpCas9 in yeast after assembly with PID fragments: TEF1p-SpCas9::KanR-1xNLS-CYC1t (KanR cassette in place of the PID)DepositorInsertTEF1p-SpCas9::KanR(in place of PID)-1xNLS-CYC1t (S. cerevisiae TEF promoter driving SpCas9 with KanR cassette replacing PID)
UseCRISPRTagsSV40 NLSExpressionYeastMutationCorrected homology relative to wild type SpCas9 (…PromoterTEF1Available SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGG442
Plasmid#165616PurposeVector for expression of SpCas9-Zif268 in yeast after assembly with PID fragments: TEF1p-SpCas9::KanR-1xNLS-3xHA-1xNLS-Zif268-1xNLS-CYC1t (KanR cassette in place of the PID)DepositorInsertTEF1p-SpCas9::KanR(in place of PID)-1xNLS-3xHA-1xNLS-Zif268-1xNLS-CYC1t
UseCRISPRTags3x HA, SV40 NLS, Zif268, and c-Myc-like NLSExpressionYeastMutationCorrected homology relative to wild type SpCas9 (…PromoterTEF1Available SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast FLVCR1b
Plasmid#218535Purposehuman FLVCR1b cDNADepositorAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast FLVCR1/FLVCR1a
Plasmid#218533Purposehuman FLVCR1/FLVCR1a cDNADepositorAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro FLVCR1_sg5
Plasmid#218522PurposesgRNA targeting human FLVCR1DepositorInsertFLVCR1 (FLVCR1 Human)
UseCRISPR and LentiviralAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v1 GFP FLVCR1_sg5
Plasmid#218521PurposesgRNA targeting human FLVCR1DepositorInsertFLVCR1 (FLVCR1 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
JPF0419v
Plasmid#124021PurposeEncodes pCAG driving expression of multicistronic Lyn-tagged iRFP713, cytoplasmic mAzamiGreen, mCerulean-tethered p38 KTR, and Histone 2B fused to mScarlet in a PiggyBac destination vectorDepositorInsertPB_pCAG-Lyn-iRFP713_pCAG-NES-mAzamiGreen_pCAG-p38KTR-mCerulean_pCAG-H2B::mScarlet
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGG422_UV5
Plasmid#165607PurposeVector for expression of the SpCas9 KG variant with sgRNA in E. coli: KG(SpCas9, D1332K/R1333G) and UV5-sgRNA (hEGFP spacer)DepositorInsertlacUV5 driving Streptococcus pyogenes Cas9 KG(D1332K/R1333G) and hEGFP-sgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialMutationD1332K and R1333G mutations in SpCas9PromoterlacUV5 driving Cas9 KG and UV5 driving sgRNAAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGG426_UV5
Plasmid#165608PurposeVector for expression of the SpCas9 VRKG variant with sgRNA in E. coli: lacUV5-VRKG(SpCas9, D1135V/S1136R/D1332K/R1333G) and UV5-sgRNA (hEGFP spacer)DepositorInsertlacUV5 driving Streptococcus pyogenes Cas9 VRKG(D1135V/S1136R/D1332K/R1333G) and hEGFP-sgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialMutationD1135V, S1136R, D1332K and R1333G mutations in Sp…PromoterlacUV5 driving Cas9 VRKG and UV5 driving sgRNAAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJH106
Plasmid#243727PurposeExpresses a chimeric form of PMPCA, where the region between residue 100 and 351 is replaced by a 250-residue XTEN linkerDepositorInsertPMPCA(1-100aa)-XTEN250-PMPCA(351aa-stop) (PMPCA Human)
UseLentiviralMutationThe region between residue 100 and 351 of PMPCA i…Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGG438
Plasmid#165486PurposeVector for expression of the SpCas9 VRKG variant in human cells: CMV-T7-humanVRKG(SpCas9, D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFLAGDepositorInsertMammalian codon-optimized Streptococcus pyogenes Cas9 VRKG(D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFlag
UseCRISPRTags3x FLAG and SV40 NLSExpressionMammalianMutationD1135V, S1136R, D1332K, and R1333G mutations in S…PromoterCMV and T7Available SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Split Cas9 D10A Nickase with GyrA intein
Plasmid#58695PurposeExpresses N-terminus of D10A SpCas9 nickase domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with C-Terminal Split Cas9 Gyra Intein for full length SpCas9 nickase productionDepositorInsertD10A Nickase humanized S. pyogenes Cas9 with Gyra Nsplit Intein
UseAAV and CRISPRTagsGyrA Nsplit Intein, HA Tag, and NLSExpressionMammalianMutationD10A nickase converting mutation to SpCas9PromoterCBhAvailable SinceSept. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSR1038
Plasmid#208737PurposeCharacterization plasmid for PCap (sfgfp expressed from PCap on the S. aureus pC194 replicon)DepositorInsertPCap
UseSynthetic BiologyExpressionBacterialPromoterPCapAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX-evoCas9
Plasmid#107550PurposeExpresses the M495V/Y515N/K526E/R661Q (evoCas9) SpCas9 variant in mammalian cellsDepositorInsertHumanized S. pyogenes Cas9
UseCRISPRTags3XFLAGExpressionMammalianMutationM495V/Y515N/K526E/R661QPromoterCBhAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only