We narrowed to 10,153 results for: tre promoter
-
Plasmid#12271DepositorAvailable SinceJuly 20, 2006AvailabilityAcademic Institutions and Nonprofits only
-
pGL3-PDE6B-146
Plasmid#239098PurposepGL3 luciferase vector with 146bp PDE6B promoter (containing NRL response element).DepositorArticleInsertPDE6B promoter (PDE6B Human)
UseLuciferaseAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-CLIP-CD28(CD45TM)
Plasmid#223629PurposeLentiviral expression of human CD28 (CD45TM) with CLIP tag in mammalian cellsDepositorInsertCD28 (CD28 Human)
UseLentiviral; mammalian expressionTagsCLIPMutationCD28 transmembrane domain replaced by CD45 transm…Available SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-Spy-CD28(CD45TM)
Plasmid#223624PurposeLentiviral expression of human CD28 (CD45TM) with SpyTag003 in mammalian cellsDepositorInsertCD28 (CD28 Human)
UseLentiviral; mammalian expressionTagsSpytag003MutationCD28 transmembrane domain replaced by CD45 transm…Available SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-SNAP-CD86(F56A)
Plasmid#223609PurposeLentiviral expression of human CD86 (F56A) with SNAP tag in mammalian cellsDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-SNAP-CD80(Y65A)
Plasmid#223608PurposeLentiviral expression of human CD80 (Y65A) with SNAP tag in mammalian cellsDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-CLIP-CD28(SGGG)
Plasmid#223607PurposeLentiviral expression of human CD28 (SGGG) with CLIP tag in mammalian cellsDepositorInsertCD28 (CD28 Human)
UseLentiviral; mammalian expressionTagsCLIPMutationMYPPPY mutated to SGGGAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLEX304-ARF5-T161A-mNeonGreen
Plasmid#162026PurposeFast cycling ARF mutantDepositorAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMDC43-FIT2-N[80]A
Plasmid#96995PurposeExpress GFP-tagged mutated mouse FIT2 gene in plants.DepositorInsertMmFIT2 (Fitm2 Mouse)
TagsGFPExpressionPlantMutationAmino acid residue 80 was mutated (N[80]A). Mutat…Promoter35SAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-BRD2
Plasmid#65376PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG_huMcl-1.1
Plasmid#85530PurposeInducible expression of guide RNA (huMcl-1.1) with fluorescent GFP reporterDepositorAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
L40C-CRISPR.EFS.mNeon
Plasmid#69146PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA (hU6), mNeon coexpression, EFS Promoter drivenDepositorInsertsUseCRISPR and LentiviralTagsFLAGAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-DDX11-Flag-KAE
Plasmid#120728PurposeExpression of a Flag-tagged version of DDX11 KAE mutant in mammalian cellsDepositorInsertDDX11 KAE mutant (DDX11 Human)
Tags3x FLAGExpressionMammalianMutationSubstitution of E201 and Y202 with K and APromoterCMVAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-DDX11-Flag-KAK
Plasmid#120729PurposeExpression of a Flag-tagged version of DDX11 KAK mutant in mammalian cellsDepositorInsertDDX11 KAK mutant (DDX11 Human)
Tags3x FLAGExpressionMammalianMutationSubstitution of E201, Y202 and E203 with K, A and…PromoterCMVAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
EW263 CMV-TO-ADAR2dd(E488Q, T501A)-PUF-9R(FLP-IN)
Plasmid#236126PurposePlasmid encoding ADAR2dd attached to PUF-9R under control of CMV promoter with two TetR binding sitesDepositorInsertADAR2dd-PUF-9R (ADARB1 Human, Synthetic)
ExpressionMammalianMutationE488Q, T501A in ADAR2ddPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-VCF1 N167A
Plasmid#223019PurposeExpression of GFP-tagged VCF1 (p97 binding-deficient N167A mutant) in mammalian cells.DepositorAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMDC43-FIT2-FLL[157-159]AAA
Plasmid#96994PurposeExpress GFP-tagged mutated mouse FIT2 gene in plants.DepositorInsertMmFIT2 (Fitm2 Mouse)
TagsGFPExpressionPlantMutationAmino acid residues 157-159 were mutated (FLL[157…Promoter35SAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMDC32-FIT2-FLL[157-159]AAA
Plasmid#96991PurposeExpress mouse FIT2 gene in plants.DepositorInsertMmFIT2 (Fitm2 Mouse)
ExpressionPlantMutationAmino acid residues 157-159 were mutated (FLL[157…Promoter35SAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.EFS.PAC
Plasmid#57828PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA, Puromycin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only