We narrowed to 6,006 results for: actin
-
Plasmid#124832PurposeMonomeric TagBFP2 and dre recombinaseDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmTagBFP2-T2A-dre
ExpressionMammalianPromoterCAGAvailable sinceJune 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pB-bsd-Flag-CNP
Plasmid#126608PurposeExpresses N-terminal Flag-tagged human CNPDepositorInsert2'3' cyclic nucleotide phosphodiesterase (CNP Mouse)
TagsFlagExpressionMammalianPromoterCAGAvailable sinceJune 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-EGFP-Snapin
Plasmid#118743PurposeExpresses EGFP tagged SnapinDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSnapin cDNA (Snapin Mouse)
TagsEGFPExpressionMammalianPromoterCAGAvailable sinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-VHC
Plasmid#112618Purposeexpression plasmid with CAG promoter driving multicistronic cassette H2BVenus_p2A_HygroR_p2A_CreERt2DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsTagsVenusExpressionMammalianPromoterCAGAvailable sinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-DDdCas9VPP300-T2A-GFP-IRES-Neo
Plasmid#102887PurposePiggyBac transposon system construct with constitutive CAG promoter expression of TMP inducible DDdCas9VP192-P300core activator followed by T2A-EGFP as a reporter and IRES-Neo as selectionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDDdCas9VP192-P300-T2A-GFP-IRES-Neo
UseCRISPRExpressionMammalianMutationD10A, H840APromoterCAGAvailable sinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-dCas9VPPH-T2A-GFP-shP53
Plasmid#102897PurposeEBNA episome plasmid for CAG promoter constitutive expression of dCas9-VP192-P300core-p65-HSF1 followed by T2A-GFP as a reporter. Includes p53 shRNA expression cassette.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdCas9VPPH-T2A-GFP-shP53
UseCRISPRExpressionMammalianMutationD10A, H840APromoterCAGAvailable sinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-ChroME(S273A)-mRuby2-ST
Plasmid#109128PurposeModified cation channelrhodopsin ChroME fused to mRuby2 fluorophore and targeted to the neuronal soma and proximal dendritesDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertChroME(S273A)-mRuby2-ST
ExpressionMammalianPromoterCAGAvailable sinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV.CAG-FLEX.SF-Venus-iGluSnFR.A184S
Plasmid#106189PurposeTight affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-Venus-iGluSnFR.A184S
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: A184SPromoterCAGAvailable sinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
TNPO1-shRNA
Plasmid#86082PurposeA lentiviral construct for building stable cell lines expressing Transportin-1 shRNA via puromycin selection.DepositorAvailable sinceMay 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPBC-G3-tdT
Plasmid#62814PurposepPBC-G3-tdT expresses PiggyBac inverted terminal repeat-flanked GCaMP3 and tdTomato under the control of the CAG promoter.DepositorInsertITR-CAG-GCaMP3-IRES-tdTomato-ITR
ExpressionBacterial and MammalianPromoterCAGAvailable sinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPBC-LG3-tdT
Plasmid#62810PurposepPBC-LG3-tdT expresses PiggyBac inverted terminal repeat-flanked Lck-GCaMP3 and tdTomato under the control of the CAG promoter.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertITR-CAG-Lck-GCaMP3-IRES-tdTomato-ITR
ExpressionBacterial and MammalianPromoterCAGAvailable sinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
CAGhCBFA2T2
Plasmid#84363PurposeFLAG-HA tagged human CBFA2T2DepositorAvailable sinceFeb. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-3xFLAG::Flcn-pgk-hph
Plasmid#48757PurposePiggyBac backbone, CAG promoter driving murine 3xFLAG-Flcn fusion, Hygromycin selectionDepositorAvailable sinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAG-EGFP-LacZshRNA
Plasmid#73977PurposeLacZshRNA (mir155 backbone) was inserted into the 3'UTR of EGFP.DepositorInsertshRNA that targets the LacZ gene
ExpressionMammalianPromoterCAGAvailable sinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 C207F
Plasmid#68829PurposeExpresses c-myc-tagged human RAD18 with C207F mutationDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertc-myc tagged human RAD18 with C207F mutation (RAD18 Human)
Tagsc-mycExpressionMammalianPromoterCAGAvailable sinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 dC2
Plasmid#68831PurposeExpresses c-myc-tagged human RAD18 deleting Polymerase eta binding domainDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertc-myc tagged human RAD18 deleting Polymerase eta binding domain (RAD18 Human)
Tagsc-mycExpressionMammalianPromoterCAGAvailable sinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAG Fzd7 GFP
Plasmid#66106Purposeexpression of chicken Fzd7 GFPDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFzd7 (FZD7 Chicken)
UseChicken expressionTagsEGFPPromoterCAGAvailable sinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only