We narrowed to 10,153 results for: tre promoter
-
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
EW267 CMV-TO-ADAR2dd(E488Q, T501A)-PUF-9R-MARIAcomp(V241D, H243M) (FLP-IN)
Plasmid#236127PurposePlasmid encoding ADAR2dd attached to PUF-9R with deimmunizing mutations under control of CMV promoter with two TetR binding sitesDepositorInsertADAR2dd-PUF-9R (ADARB1 Human, Synthetic)
ExpressionMammalianMutationE488Q, T501A in ADAR2dd; V241D, H243M in PUF-9RPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDLxR6
Plasmid#172560PurposeInducible gene expression, pCDF origin, LuxR activator, PLuxB promoter, mRFP, Streptomycin Resistance Marker.DepositorInsertLuxR-mRFP
UseSynthetic BiologyExpressionBacterialPromoterPLuxBAvailable SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCLxR6
Plasmid#172557PurposeInducible gene expression, pCOLA origin, LuxR activator, PLuxB promoter, mRFP, Streptomycin Resistance Marker.DepositorInsertLuxR-mRFP
UseSynthetic BiologyExpressionBacterialPromoterPLuxBAvailable SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDCyR6
Plasmid#172558PurposeInducible gene expression, pCDF origin, CymRAM repressor, PCymRC promoter, mRFP, Streptomycin Resistance Marker.DepositorInsertCymRAM-mRFP
UseSynthetic BiologyExpressionBacterialPromoterPCymRCAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLIX-hN1ICD
Plasmid#91897PurposeDoxycycline inducible expression of human Notch1 ICDDepositorInsertNotch1 intracellular domain (NOTCH1 Human)
UseLentiviralExpressionMammalianMutationcodons 1770 to 2555 of human NOTCH1PromoterTRE promoter, Tet ONAvailable SinceJune 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET-SUMO-mGSDMD
Plasmid#111560PurposeExpress mouse GSDMD in E.coliDepositorAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mGSDMD1-251
Plasmid#111565PurposeExpress ELANE-cleaved mouse GSDMD in mammalian cellsDepositorAvailable SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHR-SNAP-PDL1
Plasmid#223602PurposeLentiviral expression of human PD-L1 with SNAP tag in mammalian cellsDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQCXIX-Myc-hTIM3
Plasmid#110893PurposeExpression of Myc-tagged hTIM3 at the cell surfaceDepositorInsertHepatitis A virus Cellular Receptor 2 (HAVCR2) (HAVCR2 Human)
UseRetroviralTagsMycPromoterCMVAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHR-PDL1-LgBiT
Plasmid#223619PurposeLentiviral expression of human PD-L1 with LgBiT tag in mammalian cellsDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
FLAG-β-arrestin2 RRK/Q-5-kinase domain fusion protein (RRK5K)
Plasmid#38262DepositorInsertβ-arrestin2 (Arrb2 Rat)
TagsFlag and PIP5K Iα core kinase domain (residues 18…ExpressionMammalianMutationArg 233, Arg237, and Lys251 converted to Glutamin…PromoterCMVAvailable SinceAug. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-C-eGFP-Ctdnep1_D67EsiR
Plasmid#196518PurposeExpression of Ctdnep1_D67E-GFPDepositorInsertCtdnep1_D67EsiR (CTDNEP1 Human)
TagseGFPExpressionMammalianMutationD67E mutation (phosphastase dead). Silent mutatio…PromoterCMV promoter; T7 promoterAvailable SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIVTR(T7A)-NGN2 (SA Substitutions)
Plasmid#172308PurposeIn vitro transcription of NGN2 (Ser phosphosites substituted by Ala)DepositorInsertNGN2
UseOtherMutationS24A, S193A, S207A, S209A, S219A, S232A, S239A an…PromoterT7 promoter A-initiatingAvailable SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMV IkB alpha
Plasmid#12333DepositorInsertIkB alpha (Nfkbia Mouse)
ExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
M17 ptwhh-IGFP65C
Plasmid#17154DepositorInserttwhh promoter (shhb Zebrafish)
Tagsb-globin intron, GFPAvailable SinceFeb. 1, 2008AvailabilityAcademic Institutions and Nonprofits only -
pBabepuro-TGFA
Plasmid#189610PurposeRetroviral expression vector for TGFADepositorAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRRLSIN.cPPT.RFPL4b.Luciferase.WPRE
Plasmid#69252PurposeLuciferase in lentivirus backbone to report Dux4 activation of RFPL4b promoterDepositorAvailable SinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTJK422
Plasmid#138002PurposeSIX2 expression. Vector also expresses GFP under control of hUBC promoterDepositorAvailable SinceMay 18, 2020AvailabilityAcademic Institutions and Nonprofits only