We narrowed to 19,528 results for: MUT
-
Plasmid#128588PurposeAAV-mediated expression of ChrimsonR-GFP under the EF1α1.1 promoter in frt/reversed (Flp-dependent) manner.DepositorInsertChrimsonR-GFP
UseAAVTagsGFPExpressionMammalianMutationChrimson K176R mutantPromoterEF1α (1.1 kb short version)Available SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMIG-hNFATc2/C(RIT)-FLAG-AVITEV
Plasmid#74053Purposeretroviral expression plasmid for human NFATc2/C (with RIT mutation abrogating AP1 binding) with C-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman NFATc2, isoform C (NFATC2 Human)
UseRetroviralTagsAVI-TEV and FLAGExpressionMammalianMutationsilent mutation A1723C in the sequence of NM_1730…PromoterpMSCV-LTRsAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mIL6R
Plasmid#60797PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains IL6R 3' UTR and mutated miR-155 sitesDepositorInsertIL6R 3'UTR and mutated miR-155 binding site (IL6R Human)
UseLuciferaseExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMVblast_SLC38A2_N82A
Plasmid#156181PurposeCMV-driven expression of sgRNA-resistant SLC38A2 N82A mutant cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
ExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA: T…PromoterCMVAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pInducer20_SLC38A2_N82A
Plasmid#156183PurposeDox-inducible expression of sgRNA-resistant SLC38A2 N82A mutant cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
ExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA: T…PromoterTREAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-D614G-deltaFV
Plasmid#171743PurposeMammalian expression of SARS-CoV-2 Spike protein mink variant (S-GSAS-D614G-deltaFV variant)DepositorInsertSpike (S-GSAS-D614G-deltaFV variant) (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceJuly 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV6 FLAG-DNAJC5 L115R
Plasmid#246742PurposeMammalian expression of human DNAJC5 with L115R mutation, and a FLAG tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsFLAGExpressionMammalianMutationL115RPromoterCMVAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6 FLAG-DNAJC5 delL116
Plasmid#246741PurposeMammalian expression of human DNAJC5 with L115R mutation, and a FLAG tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsFLAGExpressionMammalianMutationdelL116PromoterCMVAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-G12R-IRES-mCherry
Plasmid#221023PurposeFluorescent reporter for expressing the KRAS G12R mutant CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-G12S-IRES-mCherry
Plasmid#221024PurposeFluorescent reporter for expressing the KRAS G12S mutant CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-G12A-IRES-mCherry
Plasmid#221020PurposeFluorescent reporter for expressing the KRAS G12A mutant CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-G12C-IRES-mCherry
Plasmid#221021PurposeFluorescent reporter for expressing the KRAS G12C mutant CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-G12D-IRES-mCherry
Plasmid#221022PurposeFluorescent reporter for expressing the KRAS G12D mutant CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b-ITGB1(YYFF)-mRuby2
Plasmid#215447PurposeGateway entry vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorTagsmRuby2MutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPB.DEST-ITGB1(YYFF)-mRuby2
Plasmid#215449PurposePiggybac expression vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseTransposon-based stable expressionTagsmRuby2ExpressionMammalianMutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoterCAGAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
7AA-aSyn-pRK172
Plasmid#236197PurposeThis plasmid expresses human α-synuclein with a 7-amino acid insertion (MAAAEKT) in the pRK172 backbone for bacterial expression in E. coli. The insertion corresponds to the JOS mutation.DepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA1_allW_D262V-FLAG-IRES-eGFP
Plasmid#234621PurposeMammalian expression of full-length hnRNPA1 D262V with all aromatic amino acids in the C-terminal LCD mutated to W keeping the hexapeptide fibril core (SYNDFG) and the PY-NLS intact.DepositorInserthnRNPA1 allW D262V (HNRNPA1 Human)
TagsFLAGExpressionMammalianMutationFamillial ALS mutation D262V, all aromatic amino …PromoterCMVAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGASdeltaN R255E-HA
Plasmid#186894PurposeDoxycycline-dependent expression of human cGAS gene (with R255E mutation) in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with R255E mutation and C-terminal HA tag (Adamts1 Synthetic, Human)
UseRetroviralTagsHAMutationN-terminal truncation, R255EPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+FLAG-KrascomQ61R
Plasmid#206845PurposeTo express mouse Kras encoded by common mouse codons (to increase expression) and with a Q61R mutation with an N-terminal FLAG tag.DepositorInsertKras (Kras Mouse)
TagsFLAGExpressionMammalianMutationCodons altered to most optimum based on mouse cod…Available SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only