We narrowed to 5,290 results for: crispr cas9 expression plasmids
-
Plasmid#177345PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from Synapsin promoterDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterSynapsinAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Human sgRNA library Brunello in lentiGuide-Puro (Lentiviral Prep)
Viral Prep#73178-LVPurposeReady-to-use Lentiviral Prep particles produced from Human sgRNA library Brunello in lentiGuide-Puro (#73178). In addition to the viral particles, you will also receive purified Human sgRNA library Brunello in lentiGuide-Puro plasmid DNA. Ready-to-use lentiviral pooled library for CRISPR screening in human cells. Use on cells that are stably expressing Cas9 to make edits across 19,114 genes in the human genome.DepositorAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-P-6XPyltRNA-dCas9K1151TAG-IRESPylRS
Plasmid#248695PurposeExpression dead CRISPR/Cas9 with unnatural amino acid incorporated at K1151 residueDepositorInsertdead CRISPR/Cas9 K1151TAG, MbPylRS
UseCRISPRExpressionMammalianPromoterCAGAvailable SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_PROX1_1+3
Plasmid#121176PurposeLentiviral construct for the expression of Cas9 protein and puromycin resistance from EFS promoter and two guide RNAs targeting for deletion PROX1 start codon sequence.DepositorInsertCas9-P2A-puro and U6 promoters driven expression of gRNAs
UseCRISPR and LentiviralTagsP2A-puroExpressionMammalianAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA P1
Plasmid#80943PurposeExpresses Cas9N in mammalian cells; expresses gRNA P1 for Pd-l1 binding.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1179 U6-reci Gag-Cas9 v2
Plasmid#201914PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-Cas9 v2
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
Mouse sgRNA library Brie in lentiGuide-Puro (Lentiviral Prep)
Viral Prep#73633-LVPurposeReady-to-use Lentiviral Prep particles produced from Mouse sgRNA library Brie in lentiGuide-Puro (#73633). In addition to the viral particles, you will also receive purified Mouse sgRNA library Brie in lentiGuide-Puro plasmid DNA. <p><p>Ready-to-use lentiviral pooled library for CRISPR screening in mouse cells. Use on cells that are stably expressing Cas9 to make edits across 19,674 genes in the mouse genome.</p></p>DepositorAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_PROX1_1+4
Plasmid#121177PurposeLentiviral construct for the expression of Cas9 protein and puromycin resistance from EFS promoter and two guide RNAs targeting for deletion PROX1 start codon sequence.DepositorInsertCas9-P2A-puro and U6 promoters driven expression of gRNAs
UseCRISPR and LentiviralTagsP2A-puroExpressionMammalianAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Split Cas9 D10A Nickase with GyrA intein
Plasmid#58695PurposeExpresses N-terminus of D10A SpCas9 nickase domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with C-Terminal Split Cas9 Gyra Intein for full length SpCas9 nickase productionDepositorInsertD10A Nickase humanized S. pyogenes Cas9 with Gyra Nsplit Intein
UseAAV and CRISPRTagsGyrA Nsplit Intein, HA Tag, and NLSExpressionMammalianMutationD10A nickase converting mutation to SpCas9PromoterCBhAvailable SinceSept. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177344PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from doxycycine-inducible promoterDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterTetracycline-dependent promotersAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177342PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequenceDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterCMVAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSD_FKBP-C-SpCas9MT3-574-1368-NLS-3XHA-NLS-ZFPTS3-3xFLAG-2xNLS
Plasmid#107300PurposeExpresses C terminal (574-1368 aa) R1335K mutant SpCas9 fused to FKBP and ZFP-VEGFA-TS3 in mammalian cellsDepositorInsertTruncated SpCas9 (aa 574-1368) fused to FKBP
UseCRISPRTags3x Flag, 2x NLS, FKBP, SV40NLS, 3xHA, c-Myc NLS, …ExpressionMammalianMutationTruncated SpCas9 (aa 574-1368) with R1335K mutati…PromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCSD_FKBP-C-SpCas9MT3-574-1368-NLS-3XHA-NLS-ZFPTS2-3xFLAG-2xNLS
Plasmid#107299PurposeExpresses C terminal (574-1368 aa) R1335K mutant SpCas9 fused to FKBP and ZFP-VEGFA-TS2 in mammalian cellsDepositorInsertTruncated SpCas9 (aa 574-1368) fused to FKBP
UseCRISPRTags3x Flag, 2x NLS, FKBP, SV40NLS, 3xHA, c-Myc NLS, …ExpressionMammalianMutationTruncated SpCas9 (aa 574-1368) with R1335K mutati…PromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-HF-tetra-com-vector
Plasmid#132555PurposeVector plasmid expressing high fidelity spCas9 (R691A) and sgRNA scaffold with com replacing the Tetraloop.DepositorInsertsHigh fidelity Cas9
sgRNA scaffold with com replacing the Tetraloop
ExpressionMammalianAvailable SinceMarch 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
HeFm2SpCas9
Plasmid#92111PurposeExpression plasmid for human codon-optimized increased fidelity HeFm2SpCas9 (without U6-sgRNA coding sequence)DepositorInsert“Highly enhanced Fidelity” mut2 SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, K848A, Q926A, R1060APromoterCbhAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCas9D10A_GFP
Plasmid#44720PurposeCo-expression of human codon-optimized Cas9 (D10A) mutant nickase and GFP, plasmid optimized for expression in human pluripotent stem cellsDepositorInsertCas9D10A-2A-GFP
UseCRISPRTags2A-GFPExpressionMammalianMutationD10A mutation- nickase mutantPromoterCAGAvailable SinceMay 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSMVP-Cas9N
Plasmid#80934PurposePlasmid that expresses Cas9N in mammalian cells.DepositorInsertCas9N
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
dCas9-VPR_P2A_mCherry
Plasmid#154193PurposeLentiviral expression plasmid encoding dCas9-VPR and a P2A linked mCherry markerDepositorInsertsp-dCas9-VPR_P2A_mCherry
UseLentiviralExpressionMammalianMutationD10A, H840APromoterEF1asAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAT9748-dCBE
Plasmid#163008Purposeplasmid expressing CBE with dCas9DepositorInsertdCBE
UseCRISPRTags3xFLAG and SV40 NLSExpressionMammalianPromoterEF1-aAvailable SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only