We narrowed to 44,227 results for: gats
-
Plasmid#216202PurposeChromosomal gene manipulation (gene insertion, conversion, deletion) of dairy used Lactobacillus bulgaricus, a difficult gene to manipulate, is now possible by conjugation using this pGMB1 plasmid.DepositorTypeEmpty backboneUseShuttle vector, conjugal plasmid, theta type rep…ExpressionBacterialPromoterlac promoter in pGEM-Teasy, Promoters in pAMbeta1…Available SinceJan. 21, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Rabbit GFP Cav 2.2 pMT2
Plasmid#58737Purposeexpression of GFP tagged rabbit Cav2.2 in mammalian cellsDepositorAvailable SinceSept. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
Kv7.1/pcDNA3.1
Plasmid#111452PurposeElectrophysiology in HEK cellDepositorInsertpotassium voltage-gated channel subfamily KQT member 1 isoform 1 [Homo sapiens] (KCNQ1 Human)
Tags8xHis and EGFPExpressionMammalianAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR-attL5-CRY2-mCh-attL2
Plasmid#160438PurposeEntry vector for cloning Cryptochrome2-mCherry using 2-fragment gateway recombinationDepositorAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mKate2
Plasmid#162624PurposeAllows for transcription of mKate2 control for injection into zebrafish embryos for BiFC assaysDepositorInsertmKate2
ExpressionMammalianPromoterSP6Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEntry_HCoV-OC43-Hemagglutinin-esterase
Plasmid#168943PurposeGateway-compatible Entry vectorDepositorInsertHCoV-OC43-Hemagglutinin-esterase (HE )
UseGateway-compatible entry vectorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo-hApg5(K130R)-HA
Plasmid#22949DepositorInsertHomo sapiens ATG5 autophagy related 5 homolog (S. cerevisiae) (ATG5 Human)
Tags3xHAExpressionMammalianMutation130 Lysine to ArginineAvailable SinceJune 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
Cav2.1 HA pCAGGS
Plasmid#206076Purposeexpression of rat Cav2.1 calcium channel with a E1686R mutation to enhance expression and an exofacial double HA tag in domain IIDepositorAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
p5E-CAGGS (JDW 912)
Plasmid#224472PurposeGateway compatible 5' entry clone containing the CAG promoter for constitutive expression of downstream constructs.DepositorInsertCAGGS Promoter
ExpressionMammalianAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME V5-mTagBFP2 (JDW 830)
Plasmid#224484PurposeGateway compatible middle entry clone containing V5 tagged mTagBFP2 (Cytosolic blue fluorescent reporter)DepositorInsertV5-mTagBFP2
UseGateway cloningAvailable SinceSept. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-V5-mScarlet-I_SV40pA (JDW 968)
Plasmid#224529PurposeA Gateway compatible 3' entry clone containing an V5 mScarlet fusion followed by SV40 late polyADepositorInsertV5-mScarlet-I
UseGateway cloningAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-CDC42-DN
Plasmid#109584PurposeMultisite gateway vector for 3' tagging with dominant negative CDC42DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
[pSK483] pLJC5 Flag-Depdc5(P)
Plasmid#109342PurposeLenti-viral expression of Flag-tagged Depdc5 mutant PDepositorAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRS405 PEX14-VAC8-RFP
Plasmid#166844PurposeExpresses Peroxisome localized Vac8-RFP in yeasts. Made replacing the first 21 base pairs of the VAC8 ORF with the first 390 base pairs from the PEX14 ORFDepositorTagsPEX14 transmembrane domain and RFPExpressionYeastMutationPEX14 transmembrane domainPromoterVAC8 promoterAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS405 SEC66-VAC8-RFP
Plasmid#166843PurposeExpresses ER localized Vac8-RFP in yeasts. Made replacing the first 21 base pairs of the VAC8 ORF with the first 162 base pairs from the SEC66 ORF, which encode the Sec66 transmembrane domain.DepositorTagsRFP and SEC66 transmembrane domainExpressionYeastMutationSEC66 transmembrane domainPromoterVAC8 promoterAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
[pSK496] pLJC5 HA-Depdc5(AB)
Plasmid#109346PurposeLenti-viral expression of HA-tagged Depdc5 mutant ABDepositorInsertDepdc5 (DEPDC5 Human)
UseLentiviralTagsHAMutationDIYGD(185-189)GSGSG;EQPLH(371-375)GSGSGAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC4
Plasmid#91182PurposeT-DNA vector for targeted deletion of 58kb region in Medicago truncatula (tRNA array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
[pSK497] pLJC5 Flag-Depdc5(AB)
Plasmid#109341PurposeLenti-viral expression of Flag-tagged Depdc5 mutant ABDepositorInsertDepdc5 (DEPDC5 Human)
UseLentiviralTagsFLAGMutationDIYGD(185-189)GSGSG;EQPLH(371-375)GSGSGAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC2
Plasmid#91180PurposeT-DNA vector for combinatorial deletion of NCR genes in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting NCR genes
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only