We narrowed to 31,218 results for: PLE
-
Plasmid#199365PurposeLentiviral transfer plasmid for doxycycline inducible expression of a C-terminally TEV-ALFA-P2A-BFP-tagged protein in mammalian cells.DepositorTypeEmpty backboneUseLentiviralTagsTEV-ALFA-P2A-TagBFPExpressionMammalianMutationWTAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only
-
GLG1-2Strep
Plasmid#210362PurposeExpresses GLG1 fused with 2Strep in mammalian cellsDepositorAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mTcte1-PA
Plasmid#176469PurposeExpression vector of mouse t-complex-associated testis expressed 1 (Tcte1) tagged with PA at C-terminus.DepositorAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Dest47- WTN23C11orf83-GFP
Plasmid#65845PurposeMammalian expression of the wild type N terminal part (N23, transmembrane part of 23 aa) of C11orf83/UQCC3 fused to GFP protein (C-ter)DepositorInsertTransmembrane (23 AA) of UQCC3 (UQCC3 Human)
TagsGFPExpressionMammalianMutationWT TransmembraneAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
FLAG-FLJ20309
Plasmid#15360DepositorAvailable SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pTS115 pHAGE2 CMVtetO2 MCS-3C-SUMOstar-22xGS-Alfa-P2A-TagBFP
Plasmid#199368PurposeLentiviral transfer plasmid for doxycycline inducible expression of a C-terminally 3C-SUMOstar-ALFA-P2A-BFP-tagged protein in mammalian cells.DepositorTypeEmpty backboneUseLentiviralTags3C-SUMOstar-ALFA-P2A-TagBFPExpressionMammalianMutationWTAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28b(+)-SPN+IFS
Plasmid#83372PurposeExpresses SPN and IFS complex in E. coli cellDepositorInsertsSPN
IFS
TagsHexahistidine tagExpressionBacterialPromoterT7Available SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2-Ywhag-3'UTR-MRE-3 MUT
Plasmid#61792PurposeLuciferase reporter containing the 3'UTR of mouse Ywhag with MRE-3 mutatedDepositorInsertmouse Ywhag 3'UTR with miR-200c MRE-3 mutated
UseLuciferaseMutationmiR-200c MRE-3 mutatedAvailable SinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJFRC-10XUAS-FRT-STOP-FRT-myrTdtomato-2A-KDR::Pest
Plasmid#217514PurposeEncodes a UAS controlled and Flp dependent conditional trangene of bicistronic myrTdtomato and KD RecombinaseDepositorInsert10XUAS-FRT-STOP-FRT-myrTdtomato-2A-KDR::Pest
ExpressionInsectAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-IFT38
Plasmid#218723PurposeExpresses N-terminally EGFP-tagged IFT38 in mammalian cellsDepositorAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
NSP4-EGFP
Plasmid#210378PurposeExpresses SARS-CoV-2 NSP4 fused with EGFP in mammalian cellsDepositorInsertNSP4 (ORF1ab SARS-CoV-2)
TagsEGFPExpressionMammalianMutationMany synonymous changes due to codon optimizationAvailable SinceApril 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
NSP2-Flag
Plasmid#210344PurposeExpresses SARS-CoV-2 NSP2 in mammalian cellsDepositorInsertSARS-CoV-2 NSP2 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1, Human)
TagsFlagExpressionMammalianMutationMany synonymous changes due to codon optimizationAvailable SinceApril 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
NSP3C-mCherry
Plasmid#210377PurposeExpresses the C terminal of SARS-CoV-2 NSP3 fused with mCherry tag in mammalian cellsDepositorInsertNSP3C (ORF1ab SARS-CoV-2)
TagsmCherryExpressionMammalianMutationMany synonymous changes due to codon optimizationAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
SEC61B-2Strep
Plasmid#210375PurposeExpresses SEC61B fused with 2Strep in mammalian cellsDepositorAvailable SinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
TMEM106B-2Strep
Plasmid#210360PurposeExpresses TMEM106B fused with 2Strep in mammalian cellsDepositorAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC57-RPLP15UTR-hRluc-A60
Plasmid#182639PurposeTranscription template plasmid for RPLP1 5'UTR followed by Renilla luciferase open reading frame and polyA sequenceDepositorInsertRenilla luciferase
UseLuciferaseExpressionMammalianMutationThe transcription is driven by a T7 promoter, paiā¦Available SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIG1_UL136_19kDa_EE
Plasmid#74951PurposePlasmid for mammalian expression of HCMV protein UL136. Expresses only the 19kda isoform of UL136. Also expresses EGFP.DepositorInsertUL136 (UL136 Human Cytomegalovirus strain TB40/E)
UseLentiviralTagsGlu-Glu tag (EYMPME)ExpressionMammalianMutationdelta 1-127PromoterCMV, lentiviral LTRAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCIG1_UL136_23kDa_Myc
Plasmid#74949PurposePlasmid for mammalian expression of HCMV protein UL136. Expresses only the 23kda isoform of UL136. Also expresses EGFP.DepositorInsertUL136 (UL136 Human Cytomegalovirus strain TB40/E)
UseLentiviralTagsHA Tag (YPYDVPDYA)ExpressionMammalianMutationdelta 1-99 M128APromoterCMV, Lentiviral LTRAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only