We narrowed to 16,920 results for: LIC
-
Plasmid#191766PurposeExpression of DsRed fused to a positively charged polypeptide (2 x KSG) . Overall charge on tetramer: +9eDepositorInsertDsRed
TagsN terminal fusion of positively charged polypetod…ExpressionBacterial and MammalianPromoterCMVAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHBS1412 GFP-TDP43 FYW-L
Plasmid#118801PurposeTo test the effect of sequence on nuclear body formation and splicing of full-length TDP43DepositorInsertTARDBP mutant (TARDBP Human)
UseLentiviralMutationAll FYW to L in CTD of full-length TDP43Available SinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOPTXcGMPRELUC
Plasmid#68503Purposecyclic nucleotide reporter for bacteria or plant cellsDepositorInsertOPTX promoter with cGMPRE (AT1G33440 Mustard Weed)
TagsluciferaseExpressionBacterial and PlantMutation3x cGMPRE inserted 190bp 5' of ATG (cGMPRE =…PromoterOPTX promoter with cGMPREAvailable SinceSept. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHBS1398 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 G368W]
Plasmid#118811PurposeTo test the effect of sequence on TDP43 splicing activityDepositorAvailable SinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
(PM-S608E)FLAG-Cep215-FL
Plasmid#106906PurposeExpresses murine phospho-mimetic CEP215 at S608DepositorInsertCEP215 (Cdk5rap2 Mouse)
TagsFLAGExpressionMammalianMutationchanged Serine-608 to Glutamic AcidPromoterCMVAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPICZ:hTRAAK(G124I)
Plasmid#130672PurposeP. pastoris expression vector. It will generate the human TRAAK channel (1-300) fused to a C-terminal GFPDepositorInsertKCNK4 (KCNK4 Human)
TagsSNS- 3C_cleavage_site-TAAA-GFPExpressionYeastMutationN104Q, N108Q, G124IAvailable SinceMay 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOPTXGARE
Plasmid#68542Purposecyclic nucleotide reporter for bacteria or plant cellsDepositorInsertOPTX promoter with GARE (AT1G33440 Mustard Weed)
TagsluciferaseExpressionBacterial and PlantMutation5x GARE inserted 190 bp 5' pf ATG (GARE = ta…PromoterOPTX promoter with GAREAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pP[RS3]3'M
Plasmid#53552Purposefor an easy screen of TALEN- and CRISPR/Cas9- mediated mutagenesis in DrosophilaDepositorInsertAscI and MluI restriction enzyme sites
ExpressionInsectPromotersame pP[RS3]Available SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
UbSYHRE_pDONR201
Plasmid#249817PurposeEncodes UbSYHRE (UBQ-HRE1-GAL4STE12), Gateway compatible as Donor plasmidDepositorAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHRSV_CHARMS-2xTIR
Plasmid#233930PurposeMammalian expression of Chimeric Higher-Order Assemblies for Receptor Mediated Signaling (CHARMS) variant: CHARMS-2xTIR which contain a tandem dimer of TIR domainsDepositorInsertCHARMS-2xTIR
UseLentiviralTagsmEGFPExpressionMammalianPromoterSV40Available SinceAug. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHRSV_CHARMS-bDD-5xT6BMs
Plasmid#233939PurposeMammalian expression of Chimeric Higher-Order Assemblies for Receptor Mediated Signaling (CHARMS) variant: CHARMS-bDD with 5 TRAF6 binding motifsDepositorInsertCHARMS-bDD-5xT6BMs
UseLentiviralTagsmEGFPExpressionMammalianPromoterSV40Available SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHRSV_CHARMS-V43D/E52K/R62E
Plasmid#233940PurposeMammalian expression of Chimeric Higher-Order Assemblies for Receptor Mediated Signaling (CHARMS) variant: CHARMS three mutations in the death domain that disrupt oligomer formationDepositorInsertCHARMS-V43D/E52K/R62E
UseLentiviralTagsmEGFPExpressionMammalianPromoterSV40Available SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHRSV_CHARMS-1xA
Plasmid#233924PurposeMammalian expression of Chimeric Higher-Order Assemblies for Receptor Mediated Signaling (CHARMS) variant: CHARMS-1xA which contains 1 TRAF6 binding motif with a alanine mutationDepositorInsertCHARMS-1xA
UseLentiviralTagsmEGFPExpressionMammalianPromoterSV40Available SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHRSV_CHARMS-3xA
Plasmid#233926PurposeMammalian expression of Chimeric Higher-Order Assemblies for Receptor Mediated Signaling (CHARMS) variant: CHARMS-3xA which contains 3 TRAF6 binding motif with a alanine mutationDepositorInsertCHARMS-3xA
UseLentiviralTagsmEGFPExpressionMammalianPromoterSV40Available SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHRSV_CHARMS-5xA
Plasmid#233928PurposeMammalian expression of Chimeric Higher-Order Assemblies for Receptor Mediated Signaling (CHARMS) variant: CHARMS-5xA which contains only 5 TRAF6 binding motifs with a alanine mutationDepositorInsertCHARMS-5xA
UseLentiviralTagsmEGFPExpressionMammalianPromoterSV40Available SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only