We narrowed to 4,239 results for: erf
-
Plasmid#188261PurposePlasmid ensures constitutive expression of the C-terminal fragment of split TRbeta (aa 413-460), fused to the catalytically inactive Cas9 (dCas9) protein, a flexible GS linker and the SV40 NLS signal at the N-terminusDepositorInsertcTRb413 (TXNRD2 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEMI91
Plasmid#74888PurposeShuffled 9I27 polyprotein with shuffled codons to allow facile sequencing and unique RE for the 9 cassettes for versatile cloning. See Depositor Comments for more informationDepositorInsertTitin I27 x 9 (TTN Human)
UseTagsHis-tag and Strep-tag IIExpressionBacterialMutationPromoterT7 promoterAvailable sinceJune 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLQ5079_pHR_PGK_sfGFP_CoV-F1
Plasmid#155303PurposeSARS-CoV-2 fluorescent reporter 1DepositorInsertSuperfolder GFP fused with SARS-CoV-F1 (ORF1ab Synthetic)
UseLentiviralTagsExpressionMammalianMutationPromoterPGKAvailable sinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-blast
Plasmid#191654PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain for gene silencing and the blasticidin resistance gene.DepositorInsertdSaCas9-KRAB
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationPromoterAvailable sinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAH-CTX1-rhadCas9-native
Plasmid#129392PurposeDerived from pAH-CTX1-rha. The native Streptococcus pyogenes dCas9 gene cloned downstream of PrhaBAD. Non-codon-optimized dCas9 version of pAH-CTX1-rhadCas9.DepositorInsertS. pyogenes dCas9
UseCRISPRTagsExpressionBacterialMutationAspartate 10 to Alanine, Histidine 840 to AlaninePromoterPrhaBADAvailable sinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GFP-PQRv3-RFP
Plasmid#73951PurposeProtein Quantitation Reporter (PQR) to quantify a protein of interest in mammalian cells.DepositorInsertssfGFP (superfolder GFP)
RFP
UseTagsA residual PQR peptide wii be left at the C-termi…ExpressionMammalianMutationPromoterChicken beta actin and Chicken beta actin (shared…Available sinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNSSCPG
Plasmid#183187PurposePACE-evolved split N (core) terminal of T7 RNA polymerase-SpmXΔC and SpmXΔC-PACE-evolved split C (sigma) terminal of T7 RNA polymerase both expressed under Tac promoter; sfGFP-LAA expressed under T7 pDepositorInsertssuperfolder GFP
SpmX450 and T7 181+ fusion protein
T7 RNAP 1-179 variant and SpmX450 fusion protein
mRFP1 and popZ fusion protein
UseTagsExpressionBacterialMutationPromoterAvailable sinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFLAG W96A-GLTP
Plasmid#170741PurposeThe plasmids contain inserts (ORFs) for expressing various members of the GlycoLipid Transfer Protein (GLTP) superfamily.DepositorInsertGLTP (GLTP Human)
UseTagsFLAGExpressionMammalianMutationW96APromoterAvailable sinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-dSpCas9
Plasmid#92113PurposeExpression plasmid for human codon-optimized dead/inactive SpCas9 (without U6-sgRNA coding sequence)DepositorInsertdead/inactive SpCas9 with FLAG tag
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationD10A, H840APromoterCbhAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pST_CAHS3_HYPDU (pBS0333)
Plasmid#185179PurposeFor the mammalian expression of the tardigrade protein CAHS3_HYPDU. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertCAHS3_HYPDU
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_APOE_HUMAN_E114I (pBS0839)
Plasmid#185274PurposeFor the mammalian expression of the human protein APOE_HUMAN_E114I. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertAPOE_HUMAN_E114I
UseTagsExpressionMammalianMutationE114IPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_21B
Plasmid#91129PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:AtCas9_dead + AtU6:gRNA, Plant Selection: 2x35S:hpt IIDepositorInsertEngineering Reagent: 35S:AtCas9_dead + AtU6:gRNA
UseCRISPRTagsExpressionPlantMutationD10A, H840APromoterAvailable sinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_26G
Plasmid#91149PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA , Plant Selection: PvUbi2:barDepositorInsertEngineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA
UseCRISPRTagsExpressionPlantMutationD10A, H840APromoterAvailable sinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pST_AfrLEA3m (pBS0911)
Plasmid#185285PurposeFor the mammalian expression of the brine shrimp protein AfrLEA3m. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertAfrLEA3m
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_PvLEA4_repeats_k3_26 (pBS0762)
Plasmid#185244PurposeFor the mammalian expression of the sleeping chironomid protein PvLEA4_repeats_k3_26. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertPvLEA4_repeats_k3_26
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_25G
Plasmid#91144PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA , Plant Selection: PvUbi2:hpt IIDepositorInsertEngineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA
UseCRISPRTagsExpressionPlantMutationD10A, H840APromoterAvailable sinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFLAG CPTP
Plasmid#170742PurposeThe plasmids contain inserts (ORFs) for expressing various members of the GlycoLipid Transfer Protein (GLTP) superfamily.DepositorInsertCPTP (CPTP Human)
UseTagsFLAGExpressionMammalianMutationPromoterAvailable sinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-SID4X-pU6-sgRNA
Plasmid#158989PurposeVector F encodes pAAV-pMecp2-dSaCas9-SID4X-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR interference in neuronsDepositorInsertdSaCas9-SID4X
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterpMecp2Available sinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFA0055
Plasmid#131774PurposeGuide RNA (gCASS5a) and Cas9 expression plasmid for cleaving pFA6 series deletion cassettes, including KanMX, hphMX and natMX. Used to perform CRISPR-Swap of alleles.DepositorInsert20mer CASS5a guide (gCASS5a) and 5' sgRNA
UseTagsExpressionBacterial and YeastMutationPromoterAvailable sinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only