We narrowed to 25,483 results for: Nes
-
Plasmid#138374PurposeBooster-PKA for the generation of miceDepositorInsertlox-mCherry-lox-Booster-PKA
ExpressionMammalianPromoterCAGAvailable SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-syn-NES-jGCaMP8f-WPRE
Plasmid#186035PurposeAAV-mediated cytosolic expression of jGCaMP8f under the synapsin promoterDepositorInsertNES-jGCaMP8f
UseAAVTagsNES-6xHisExpressionMammalianPromotersynapsinAvailable SinceJuly 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-NES-MBP-cATOM(Ras)
Plasmid#209711PurposeMammalian expression of c-ATOM biosensor for HRas with nuclear export signalDepositorInsertNES-MBP-cATOM(Ras)
TagsNES-MBPExpressionMammalianAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
867 pSG5L HA NES PTEN G129R
Plasmid#10934DepositorAvailable SinceJan. 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
R4pGWB601_UBQ10p-BirA(R118G)-NES-YFP
Plasmid#127363PurposeBinary vector for expressing cytosolic BirA* (R118G)-YFP under the UBQ10 promoter in plantsDepositorInsertBirA* (R118G mutant)
TagsGS linker, NES, V5, and YFPExpressionPlantMutationR118GPromoterArabidopsis UBQ10 promoterAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mCherry-PKAsub-RLuc8N-NES
Plasmid#138211PurposeEncodes substrate fragment of luminescence-based bimolecular PKA activity reporter (LumAKAR); cytosol targeted. Use in conjunction with pcDNA3-RLuc8C-FHA1-NES.DepositorInsertmCherry-PKAsub-RLuc8N-NES
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-myc NES- mCE(K294A)
Plasmid#82464PurposeExpresses myc tag and catalytic inactive form of mRNA capping enzyme with N terminal Nuclear export signal (NES)DepositorInsertNES mRNA capping enzyme (Rngtt Mouse, HIV)
TagsmycExpressionMammalianMutationK294APromoterCMVAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-bio-myc-NES-EGFP
Plasmid#112712PurposeFor tetracycline-inducible expression of bio-myc-NES-EGFP in mammalian cellsDepositorInsertEGFP
TagsHIV Rev nuclear localization signal (NES), biotin…ExpressionMammalianMutationNucleotide sequence optimized for synthetic gene …PromoterCMV with Tet repressor binding sitesAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC2234 - pAAV Nestin GFP-iCre
Plasmid#228443PurposeAn adeno-associated viral vector to express GFP-iCre fusion protein under the human Nestin 2nd intron enhancer.DepositorInsertGFP-iCre
UseAAVExpressionMammalianAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
(nested-DIAL-YB_TATA)-mGL-BGH_pKG2876
Plasmid#246332Purposenested DIAL Reporter Plasmid with YB_TATA expressing mGreenLantern in the presence of ZFa and editable by Cre and VCre recombinaseDepositorInsertmGreenLantern
UseSynthetic BiologyExpressionMammalianMutationnoneAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-HyPerFLEX-NES-WPRE
Plasmid#217562PurposeMammalian expression of HyPerFLEX targeted to the cytoplasmDepositorInsertHyPerFLEX-NES
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-MLLn-CAGEn-NES (Nrdj1)
Plasmid#241412PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Figure 2 & Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-MLLn-CAGEn-NES (Npu)
Plasmid#241411PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-AMLn-CAGEn-NES (Nrdj1)
Plasmid#241408PurposeProximity-triggered Protein Trans-Splicing to generate the splice product AML1-ETO, Figure 2 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-NES-CAGEc-AF9c (Npu)
Plasmid#241413PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorInsertNES-CAGEc-AF9c (Npu) (MLLT3 Synthetic, Human)
Tags3xFLAG and HAExpressionMammalianPromoterCMVAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-NES-CAGEc-ETOc (Npu)
Plasmid#241409PurposeProximity-triggered Protein Trans-Splicing to generate the splice product AML1-ETO, Extended Figure 3 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorInsertNES-CAGEc-ETOc (Npu) (RUNX1T1 Synthetic, Human)
Tags3xFLAG and HAExpressionMammalianPromoterCMVAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-NES-CAGEc-HOXA9c (Nrdj1)
Plasmid#241416PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Figure 2 & Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorInsertNES-CAGEc-HOXA9c (Nrdj1) (HOXA9 Synthetic, Human)
Tags3xFLAG and HAExpressionMammalianPromoterCMVAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-NES-CAGEc-AF9c (Nrdj1)
Plasmid#241414PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Figure 2 & Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorInsertNES-CAGEc-AF9c (Nrdj1) (MLLT3 Synthetic, Human)
Tags3xFLAG and HAExpressionMammalianPromoterCMVAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-NES-CAGEc-HOXA9c (Npu)
Plasmid#241415PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorInsertNES-CAGEc-HOXA9c (Npu) (HOXA9 Synthetic, Human)
Tags3xFLAG and HAExpressionMammalianPromoterCMVAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-NUP98n-CAGEn-NES (Npu)
Plasmid#241417PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-AMLn-CAGEn-NES (Npu)
Plasmid#241407PurposeProximity-triggered Protein Trans-Splicing to generate the splice product AML1-ETO, Extended Figure 3 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-NES-SomaFRCaMPi
Plasmid#232836PurposeAAV transfer plasmid for CAG-mediated Cre-dependent expression of soma-targeted FRCaMPiDepositorAvailable SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-NUP98n-CAGEn-NES (Nrdj1)
Plasmid#241418PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Figure 2 & Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CaMKII-RFP-p2A-DAAO-NES
Plasmid#238918PurposeMammalian expression of DAAO with a nuclear export signal and RFP as a reporter in excitatory neuronsDepositorInsertRFP-p2A-DAAO-NES
UseAAVExpressionMammalianPromoterCaMKIIalfaAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CMV-RFP-p2A-DAAO-NES
Plasmid#238920PurposeExpression of DAAO with a nuclear export signal and RFP as a reporter in mammalian cellsDepositorInsertRFP-p2A-DAAO-NES
UseAAVExpressionMammalianPromoterCMVAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-FLAG-APEX2-NES-HIS3
Plasmid#229230PurposeTemplate plasmid for the endogenous tagging with FLAG-APEX2-NAS in yeastDepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-FLAG-APEX2-NES-K.l.LEU2
Plasmid#229229PurposeTemplate plasmid for the endogenous tagging with FLAG-APEX2-NAS in yeastDepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-FLAG-APEX2-NES-NatMX6
Plasmid#229231PurposeTemplate plasmid for the endogenous tagging with FLAG-APEX2-NAS in yeastDepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-FLAG-APEX2-NES-TRP1
Plasmid#229228PurposeTemplate plasmid for the endogenous tagging with FLAG-APEX2-NAS in yeastDepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only