We narrowed to 9,012 results for: CAG
-
Plasmid#91216Purposeprotoplast vector for targeted deletion of 6 genes in tomatoDepositorInsertgRNAs targeting 6 tomato genes
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS511b
Plasmid#87387PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS511b sequence CAGTGTATGCCAGTCAGCCA in yeast chromosome 5.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS511b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-11mer-35kb-DSF-1-11
Plasmid#227489Purpose11-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUDP123
Plasmid#107269PurposepUDP123 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes OpADE2 and OpNIAD and Spcas9D147Y P411T in O. parapolymorpha (HH-gRNAOpADE2-HDV-linker-HH-gRNAOpNIAD-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting OpADE2 and NIAD in O. parapolymorpha
UseTagsExpressionYeastMutationPromoterScTDH3Available sinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode22
Plasmid#226193PurposeExpression mappingDepositorInsertSyn Barcode22
UseAAVTagsExpressionMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
SGEP-sh-Hs-PHGDH-1956
Plasmid#188670PurposeshRNADepositorInsertshPHGDH (PHGDH Human)
UseCRISPR and LentiviralTagsExpressionMutationWTPromoterAvailable sinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ WRKY28_2
Plasmid#126900PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmStayGold_I3
Plasmid#239336PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with mStayGold in mammalian cells. Assembles into nanocages tagged with 60 FPs.DepositorInsertI3-01
UseTagsmStayGoldExpressionMammalianMutationK129APromoterCMVAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmCherry_I3
Plasmid#239340PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with mCherry in mammalian cells. Assembles into nanocages tagged with 60 FPs.DepositorInsertI3-01
UseTagsmCherryExpressionMammalianMutationK129APromoterCMVAvailable sinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pI3_EGFP
Plasmid#239335PurposeExpresses the I3-01 nanocage subunit C-terminally tagged with EGFP in mammalian cells. Assembles into nanocages tagged with 60 EGFPs.DepositorInsertI3-01
UseTagsEGFPExpressionMammalianMutationK129APromoterCMVAvailable sinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmBaoJin_I3
Plasmid#239337PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with mBaoJin in mammalian cells. Assembles into nanocages tagged with 60 FPs.DepositorInsertI3-01
UseTagsmBaoJinExpressionMammalianMutationK129APromoterCMVAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmScarlet3_I3
Plasmid#239342PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with mScarlet3 in mammalian cells. Assembles into nanocages tagged with 60 FPs.DepositorInsertI3-01
UseTagsmScarlet3ExpressionMammalianMutationK129APromoterCMVAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmScarlet-I_I3
Plasmid#239341PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with mScarlet-I in mammalian cells. Assembles into nanocages tagged with 60 FPs.DepositorInsertI3-01
UseTagsmScarlet-IExpressionMammalianMutationK129APromoterCMVAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmRuby3_I3
Plasmid#239344PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with mRuby3 in mammalian cells. Assembles into nanocages tagged with 60 FPs.DepositorInsertI3-01
UseTagsmRuby3ExpressionMammalianMutationK129APromoterCMVAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmScarlet3-H_I3
Plasmid#239343PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with mScarlet3-H in mammalian cells. Assembles into nanocages tagged with 60 FPs.DepositorInsertI3-01
UseTagsmScarlet3-H (a.k.a. mYongHong)ExpressionMammalianMutationK129APromoterCMVAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmStayGold_mStayGold_I3
Plasmid#239339PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with two copies of mStayGold in mammalian cells. Assembles into nanocages tagged with 120 FPs.DepositorInsertI3-01
UseTagsmStayGoldExpressionMammalianMutationK129APromoterCMVAvailable sinceJune 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmStayGold(E138D)_I3
Plasmid#239338PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with mStayGold(E138D) in mammalian cells. Assembles into nanocages tagged with 60 FPs.DepositorInsertI3-01
UseTagsmStayGold(E138D)ExpressionMammalianMutationK129APromoterCMVAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
OgeuIscB GCA RNA
Plasmid#222864PurposeThis plasmid codes for the guide of the OgeuIscB with a GCA targetDepositorInsertOgeuIscB omega RNA with a (GCA)6 target sequence
UseCRISPRTagsExpressionMammalianMutationPromoterHuman U6Available sinceOct. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
OgeuIscB AGC RNA
Plasmid#222866PurposeThis plasmid codes for the guide of the OgeuIscB with a AGC targetDepositorInsertOgeuIscB omega RNA with a (AGC)6 target sequence
UseCRISPRTagsExpressionMammalianMutationPromoterHuman U6Available sinceOct. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pWT055b
Plasmid#96877Purposetheophylline-agRNA-FANCFDepositorInserttheophylline-agRNA-FANCF
UseTagsExpressionMammalianMutationPromoterAvailable sinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only