We narrowed to 541 results for: gcg.2
-
Plasmid#174153PurposeLentiviral vector expressing Cas9 and a sgRNA against the human AMBRA1 geneDepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pKHH030_sgAMBRA1#2
Plasmid#174147PurposeLentiviral vector expressing a sgRNA against the human AMBRA1 geneDepositorAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgMARK2-R-2
Plasmid#229435Purposeknockout of MARK2DepositorInsertsgMARK2-R-2 (MARK2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6;bU6;EFSAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMCB320 sgCdkn1a.2
Plasmid#227946PurposesgRNA targeting Cdkn1a, mCherry, puromycin resistance, Mammalian expression, Mouse targeting, lentiviral, CRISPRDepositorAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1-49535-sgFmr1_CGG5-2
Plasmid#222964PurposeTargeting FMR1 5' UTR for CGG deletionDepositorInsertFMR1 sgRNA (FMR1 Human)
UseCRISPRAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shCHAC1 #2
Plasmid#242701PurposeshRNA knockdown human CHAC1 geneDepositorInsertCHAC1 (CHAC1 Human)
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgWrn#2/Cre
Plasmid#173626PurposeExpresses a Wrn-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Wrn (Wrn Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.1_puro_shJUND #2
Plasmid#136583PurposeExpresses an inducible short hairpin targeting human JUND sequenceDepositorAvailabilityAcademic Institutions and Nonprofits only -
Ssh3 gRNA#2
Plasmid#163401PurposeCas9-mediated knockout of Ssh3 in mammalian cellsDepositorAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBzCas13b-gRNA-2
Plasmid#164859PurposeConstitutive expression of single-spacer CRISPR array with spacer #2 targeting deGFP mRNA for BzCas13b in bacteria.DepositorInsertBzCas13b-gRNA-2
ExpressionBacterialPromoterJ23119Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLsCas13a-gRNA-2
Plasmid#164866PurposeConstitutive expression of single-spacer CRISPR array with spacer #2 targeting deGFP mRNA for LsCas13a in bacteria.DepositorInsertLsCas13a-gRNA-2
UseCRISPRExpressionBacterialPromoterJ23119Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDY1623 NOLC1 sgRNA 2
Plasmid#234834PurposesgRNA 2 for NOLC1 STITCHR insertionDepositorInsertNOLC1 sgRNA (NOLC1 Human)
UseCRISPRAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330A-T#2
Plasmid#171516Purposedeletion of a genomic locus in T(Brachyury) geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-RRBP1-2
Plasmid#92157PurposeCRISPR guide RNA targeting human RRBP1DepositorInsertRRBP1 sgRNA-2
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
shCDK4/6(2)
Plasmid#73555Purposevector encoding both shRNA against CDK4(2) and shRNA against CDK6(2)DepositorInsertshRNA against CDK4 + shRNA against CDK6
UseRetroviralExpressionMammalianPromoterLTRAvailable SinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgC17orf89-2
Plasmid#86135PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C17orf89DepositorInsertsgRNA targeting C17orf89 (NDUFAF8 )
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 Ch2-2
Plasmid#184486PurposeLentivirus gRNA targeting Ch2-2 (control)DepositorInsertCh2-2
UseLentiviralAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Grin1 gRNA#2
Plasmid#169790PurposeCas9-mediated knockout of Grin1 in mammalian cellsDepositorAvailable SinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d-sgCiCh2-2
Plasmid#202444PurposeExpression of a CRISPRi control sgRNA that cuts an intergenic region on chromosome 2DepositorInsertChromosome 2 gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only