We narrowed to 7,057 results for: crispr cas9 plasmids
-
Plasmid#58252PurposeU6 promoter-driven single guide RNA complementary to the human AAVS1 locusDepositorInsertU6.gRNAS1 cassette
UseAdenoviral and CRISPRExpressionMammalianAvailable SinceSept. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCSN061
Plasmid#101725PurposeSingle copy yeast plasmid expressing Cas9 from Streptococcus pyogenes (SpCas9), codon optimized for expression in Saccharomyces cerevisiae.DepositorInsertsS. pyogenes Cas9 codon optimized for expression in S. cerevisiae. (NEWENTRY )
KanMX marker expression cassette.
UseCRISPRTagsSV40 NLSExpressionYeastPromoterHeterologous TEF1 promoter from A. gossypii. and …Available SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgRNA1_MYOD1
Plasmid#64136PurposePhotoactivatable transcription system. Lentiviral expression of MYOD1 sgRNA1. Also contains a CMV-puro-t2A-mCherry expression cassette.DepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgRNA2_MYOD1
Plasmid#64137PurposePhotoactivatable transcription system. Lentiviral expression of MYOD1 sgRNA2. Also contains a CMV-puro-t2A-mCherry expression cassette.DepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgRNA4_MYOD1
Plasmid#64139PurposePhotoactivatable transcription system. Lentiviral expression of MYOD1 sgRNA4. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgRNA3_MYOD1
Plasmid#64138PurposePhotoactivatable transcription system. Lentiviral expression of MYOD1 sgRNA3. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pROS13
Plasmid#107927Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEF1a_ABE9-SpRY
Plasmid#242977PurposeA-to-G base editor fused to PAM-flexible SpRY-Cas9 nickase.DepositorInsertpEF1α-TadA-8e (N108Q/L145T)-nSpRYCas9
UseCRISPRTags6*HisExpressionMammalianPromoterEF1aAvailable SinceFeb. 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTP63.1.0-gDNA
Plasmid#132432PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertTP63 (TP63 Human)
UseCRISPRAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCREB5.1.0-gDNA
Plasmid#132475PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertCREB5 (CREB5 Human)
UseCRISPRAvailable SinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pESRRG.1.0-gDNA
Plasmid#132473PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertESRRG (ESRRG Human)
UseCRISPRAvailable SinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGABPB2.1.0-gDNA
Plasmid#132457PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertGABPB2 (GABPB2 Human)
UseCRISPRAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDLX4.1.0-gDNA
Plasmid#132437PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertDLX4 (DLX4 Human)
UseCRISPRAvailable SinceDec. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
IL1RN gRNA3
Plasmid#113132PurposeExpresses gRNA targeting the IL1RN promoter (SpyCas9 scaffold)DepositorInsertIL1RN guideRNA 3 (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
IL1RN gRNA2
Plasmid#113131PurposeExpresses gRNA targeting the IL1RN promoter (SpyCas9 scaffold)DepositorInsertIL1RN guideRNA 1 (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP123
Plasmid#107269PurposepUDP123 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes OpADE2 and OpNIAD and Spcas9D147Y P411T in O. parapolymorpha (HH-gRNAOpADE2-HDV-linker-HH-gRNAOpNIAD-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting OpADE2 and NIAD in O. parapolymorpha
ExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti sgRNA NGFR GFP out of frame
Plasmid#155282PurposeLentiviral plasmid for sgRNA, NGFR marker, editing detected with GFP, used with 155280DepositorInsertGFP out of frame IRES NGFR
Available SinceSept. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSP571
Plasmid#139498PurposeCRISPR-Cas9 plasmid to generate double strand break in STL1 locus in S. cerevisiae. Expresses both Cas9 and STL1 sgRNADepositorInsertpGPD Cas9 / sgRNA (STL162)
ExpressionYeastMutationWTPromoterpGPDAvailable SinceJune 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only