We narrowed to 30,316 results for: promoter
-
Plasmid#153389PurposeConfers resistance to kanamycin and G418DepositorInsertNptII
ExpressionPlantAvailable SinceOct. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
Il12b 400bp pro-Luc
Plasmid#20020DepositorAvailable SinceJan. 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
DT034A
Plasmid#159395PurposeConstitutive LuxR expression, controlled under E.coli hybrid (J23117-J23106) promoter, and inducible Perfringolysin O (PFO) expression, controlled under V. fischeri HSL-regulated pLux (luxPR) promoterDepositorInsertpr.J23117/J23106-LuxR-pr.LuxR-PFO-pdt
UseSynthetic BiologyTagsFLAG/FLAG and pdt#3 from Collins Nat. Biotech. 20…ExpressionBacterialPromoterJ23117 and pLux promoterAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMV306DIhsp+LuxG13
Plasmid#49999PurposeIntegrase removed to increase stability of the plasmid in mycobacteriaDepositorInsertBacterial luciferase operon + G13 promoter
ExpressionBacterialMutationIt contains a gram-positive enhanced translation …PromoterG13 from M. marinum G13 promoter driving luxCAvailable SinceMay 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPB-p53RE(CDKN1A)-CMVmin-mScarlet-I-NLSx3-AU1-PGKpuro
Plasmid#241845PurposeExpresses p53 transcription fluorescence reporter in mammalian cells.DepositorInsertCDKN1A promoter (CDKN1A Human)
TagsmScarlet-I-3xNLSExpressionMammalianMutationCDKN1A promoter (1015 bp) + CMV minimal promoter …Promotern/aAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pTH-iCre-WPREpA
Plasmid#213130PurposeTruncated rat TH promoter expressing iCreDepositorInsertiCre
UseAAV and Mouse TargetingTagsNoneExpressionMammalianPromoterTruncated TH promoter from rat (Rattus norvegicus…Available SinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-NBRE3
Plasmid#208254PurposepGL3 promoter luciferase reporter vector containing 3 copies of the NBRE DNA response element (5′-GAGTTTTAAAAGGTCATGCTCAATT TGTC-3′) used for luciferase reporter assays in mammalian cellsDepositorInsert3X NBRE-LUC
ExpressionMammalianPromoterSV40 early promoterAvailable SinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
HIP-flash (HOP-flash mutant)
Plasmid#83466PurposeNegative control for HOP-flash. 7xmut TEAD binding sites with minimal promoter plus luciferase reporter geneDepositorInsertMultimerized mutated TEAD binding sites in the promoter of CTGF with minimal promoter (CCN2 Human)
UseLuciferaseAvailable SinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pTH-iCre:EGFP-WPREpA
Plasmid#213142PurposeTruncated rat TH promoter expressing iCre fused to EGFPDepositorInsertiCre
UseAAVTagsEGFPExpressionMammalianPromoterTruncated TH promoter from rat (Rattus norvegicus…Available SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMV0067 [15ARE23bp -p(cFos)-fLuc-UBC-rLuc-P2A-GFP]
Plasmid#246421PurposeFirefly luciferase driven by an AHR responsive minimal cFOS promoter and a renilla luciferase and GFP driven by a constitutive UBC promoter flipped with respect to the lentiviral backboneDepositorInsertsFirefly luciferase
Renilla luciferase-P2A-EGFP
UseLentiviralExpressionMammalianPromoterAHR responsive minimal cFOS promoter and UbCAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGfa2-nLac
Plasmid#53126PurposeExpression of LacZ driven by the human Gfa2 promoter. LacZ can also be replaced with the gene of interest for targeting transgene expression to astrocytes in mice.DepositorInsertGfa2 (GFAP Human)
UseMouse TargetingTagsLacZ, NLS, and mP1ExpressionMammalianMutationcontains -2163 to +47 (the human gfa2 segment), w…Promoterhuman GFAPAvailable SinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
SPDK3876(TRV-RNA2-pPEBV-MCS)
Plasmid#149275PurposeModified Tobacco rattle virus RNA2 vector that could be used for expression of proteins or RNAsDepositorInsertModified TRV RNA2 with PEBV promoter
UseT-dna vectorMutationT2318C (DNA) in PEBV coat protein sequenceAvailable SinceJune 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hNR2F2-RFP
Plasmid#22926DepositorInserthuman nuclear receptor subfamily 2 group F member 2 promoter driving DsRedExpress (NR2F2 Human)
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pIS1-Vim/Actb5UTR-renilla
Plasmid#38238DepositorUseLuciferaseExpressionMammalianMutationActb promoter (1000 nt upstream) and 5' UTR …PromoterEndogenous VimAvailable SinceNov. 7, 2012AvailabilityAcademic Institutions and Nonprofits only -
p8327 pLIX YAP1 S127A
Plasmid#184528PurposeExpression of YAP1 S127ADepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVXCMV100-mNeonGreen-PBD
Plasmid#241366PurposeLentiviral expression of mNeonGreen-tagged PAK1 p21-binding domain (PBD)DepositorInsertPak1 fragment (PAK1 Human)
UseLentiviralTagsmNeonGreenMutationaa 57-141PromoterTruncated CMV promoterAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRR-AR
Plasmid#73045PurposeConstitutively expresses the androgen receptor, which is required for the activation of the promoter in pLAREG (Addgene plasmid #73045)DepositorInsertAndrogen receptor (AR Human)
ExpressionYeastMutationplease see depositor comments belowPromoterglyceraldehyde phosphate dehydrogenase (GPD)Available SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNW538_pAAVS1-pAP1(2)-FlpO-ABI-P2A-PYL-FlpO-CAG-U1-frt-STOP-frt-U2-GFP-P2A-luc2-ZeoR
Plasmid#192939PurposeFlpO-based digitizer circuit driven by AP1 promoterDepositorInsertsAP1(2)/minTK promoter
FlpO-ABI
PYL-FlpO
CAG promoter
frt-STOP-frt
GFP
luciferase
pPGK
Zeocin resistance
BFP
UseSynthetic BiologyExpressionMammalianAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hADM-RFP
Plasmid#22922DepositorAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only