We narrowed to 4,483 results for: ARA-2
-
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWormgate2-myo-2p-mCherry-P2A-flag-UltraID
Plasmid#227172PurposeFor organ-specific expression of separated mCherry and UltraID in the pharyngeal muscle of C. elegans.DepositorInsertmCherry::P2A::UltraID
UseTagsExpressionWormMutationPromotermyo-2Available sinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C2-KRf-TetR
Plasmid#216269PurposeConstruct 2: Lipid binding domain KRφ - TetRDepositorInsertLipid binding motif (KRf) - TetR
UseTagsEGFPExpressionMammalianMutationPromoterAvailable sinceMay 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-24p3/LCN2-Luc
Plasmid#25463DepositorInsert24p3/lipocalin 2 proximal promoter (Lcn2 Mouse)
UseLuciferaseTagsExpressionMutationnonePromoterAvailable sinceJune 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pHelper-CBE-sgRNA
Plasmid#221137PurposeHelper plasmid for sgRNA cloning for CRISPR-Cas9 cytosine base editing. sgRNA-scaffold with Cas9 handle expressed from constitutive bacterial promoter J23119(SpeI). 2 BbsI sites for sgRNA cloning.DepositorInsertsgRNA-scaffold with Cas9 handle
UseCRISPRTagsExpressionBacterialMutationPromoterJ23119(SpeI)Available sinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
JDW 1060 (pME_V5_FOXF2_P2A_H2A_mCherry)
Plasmid#232131PurposeA middle entry gateway clone containing V5 tagged human FOXF2 and an H2A tagged mCherry, separated by a P2A peptide cleavage sequence.DepositorInsertFOXF2 (FOXF2 Human)
UseGateway cloningTagsV5ExpressionMutationPromoterAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ACE2 receptor 19-615
Plasmid#167012PurposeGateway-compatible Entry vector encoding ACE2 receptor (aa19-615) interacting with spike (S1) RBD domain from SARS-CoV-2DepositorInsertACE2 (ACE2 Human)
UseTagsExpressionMammalianMutationAmino acids 19-615, No stop codonPromoterAvailable sinceMarch 29, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
LV-AR-R599A-N600A
Plasmid#171221PurposeLenti-viral expression of human androgen receptor DNA-binding mutant: R599A-N600A, mutations in the D-box of the Zinc finger 2 that mediates AR dimerization.DepositorInsertAR-R599A-N600A (AR Human)
UseLentiviralTagsFlagExpressionMammalianMutationAR-R599A-N600APromoterEF-1aAvailable sinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_HLA-cmyc-GRM3 C127A TMD L624N
Plasmid#140455PurposeMammalian expression plasmid for c-myc-tagged mGluR3 C127A and L624N mutantDepositorInsertGRM3 (GRM3 Human)
UseTagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationCysteine 127 to alanine, leucine 624 to asparaginePromoterAvailable sinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_HLA-cmyc-GRM3 C127A TMD A634N
Plasmid#140456PurposeMammalian expression plasmid for c-myc-tagged mGluR3 C127A and A634N mutantDepositorInsertGRM3 (GRM3 Human)
UseTagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationCysteine 127 to alanine, alanine 634 to asparaginePromoterAvailable sinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
mEos3.2GG
Plasmid#203756PurposeEncodes a modified version of the membrane anchor of KRas, including the last 16 residues of the C terminus, with mEos3.2 fused to the N terminus. The base pairs encoding the CAAX box for KRas were replaced by the CAAX box from rap1B, resulting in a geranylgeranylation instead of farnesylation. Used as a fluorescent plasma membrane probe.DepositorInsertKRas c-term (KRAS Human)
UseTagsmEos3.2ExpressionMammalianMutationPromoterAvailable sinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-tetO-hNIL
Plasmid#197089PurposePiggyBac plasmid with tet-inducible expression of transcription factors for motor neuron differentiationDepositorUseTagsExpressionMammalianMutationPromoterTRE3GAvailable sinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD-GINKO1
Plasmid#113111PurposeBacterial expression of genetically encoded green fluorescent potassium ion indicator GINKO1DepositorInsertGINKO1
UseTags6-His Tag, T7 tag (gene 10 leader), and Xpress™ t…ExpressionBacterialMutationPromoteraraBADAvailable sinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSiMPlk_N + pSiMPlk_C
Plasmid#134310PurposeMaintenance of 2 plasmids with a single antibiotic in E. coliDepositorInsertkanR_gp41-1 N-intein + kanR_gp41-1 C-intein
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSiMPlc_N + pSiMPlc_C
Plasmid#134312PurposeMaintenance of 2 plasmids with a single antibiotic in E. coliDepositorInsertcmR_gp41-1 N-intein + cmR_gp41-1 C-intein
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSiMPla_N + pSiMPla_C
Plasmid#134314PurposeMaintenance of 2 plasmids with a single antibiotic in E. coliDepositorInsertampR_gp41-1 N-intein + ampR_gp41-1 C-intein
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV MN (eGFP)
Plasmid#89932PurposeExpresses the MN fragment only of the sMTase system for targeted DNA methylation in mammalian cells. Contains a eGFP marker expressed off separate promoter.DepositorInsertMN
UseTagsHAExpressionMammalianMutationM.SssI residues 2-272 fragmentPromoterCMVAvailable sinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSiMPlh_N + pSiMPlh_C
Plasmid#134316PurposeMaintenance of 2 plasmids with a single antibiotic in E. coliDepositorInserthygR_gp41-1 N-intein + hygR_gp41-1 C-intein
UseTagsExpressionBacterialMutationP254Q in hygR_gp41-1 N-inteinPromoterAvailable sinceFeb. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
mEGFP-N1-SAV1
Plasmid#166476PurposeExpresses fusion of mEGFP and SAV1DepositorInsertmEGFP, SAV1 (SAV1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only