We narrowed to 4,684 results for: ARA-2
-
Plasmid#139483PurposeExpresses PIF3-mEGFP in mammalian cells.DepositorInsertPIF3 (PIF3 Mustard Weed)
UseLentiviralTagsmEGFPExpressionMammalianMutationPIF3 1-100 aaPromoterHuman EF1a promoterAvailable SinceApril 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN186
Plasmid#91573PurposeExpress sgRNA targeting human AKT3DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN187
Plasmid#91574PurposeExpress sgRNA targeting human AKT3DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCSIIneo-TRE-hPhyB621- mCherry-HRasCT
Plasmid#139482PurposeExpresses PhyB621-mCherry-HRasCT in mammalian cells.DepositorInsertPhyB621 (PHYB Mustard Weed)
UseLentiviralTagsmCherry-HRasCTExpressionMammalianMutationG229L and deletion of aa Y at position 235 in mch…PromoterTet responsible elementAvailable SinceApril 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T-1 Slp2-a C2AB
Plasmid#40058DepositorInsertSlp2-a C2AB (Sytl2 Mouse)
TagsGSTExpressionBacterialMutationC2AB domains onlyPromoterTacAvailable SinceNov. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCKC017
Plasmid#226622PurposepLenti wt hTdT template for libraries 1-2DepositorInsertTerminal deoxynucleotidyl transferase (DNTT Human)
UseLentiviral and Synthetic BiologyExpressionMammalianMutationsynonymous mutation in D2, synonymous mutation in…PromoterCMVAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMeCP2Y pc644
Plasmid#167565PurposeThe complete rat MeCp2 ORF is fused in frame of the NH2-terminus of the enhanced YFP (pEYFP-N1 vector; CLONTECH Laboratories, Inc.)DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pClgn1.1_Dcst2-3xHA
Plasmid#183541PurposeExpress Dcst2-3xHA under the mouse Clgn promoter.DepositorAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_LC_R191K_R254K
Plasmid#104466Purposeexpress MBP hnRNPA2 LC with 2 R to K mutationsDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 P676C I730C (NT809)
Plasmid#50866PurposeExpresses human NKCC1 P676C I730C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationP676C I730C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 I674C (NT475)
Plasmid#50875PurposeExpresses human NKCC1 I674C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationI674C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 N680C A734C (NT816)
Plasmid#50870PurposeExpresses human NKCC1 N680C A734C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationN680C A734C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 L737C (NT523)
Plasmid#50891PurposeExpresses human NKCC1 L737C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationL737C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 P676C A734C (NT810)
Plasmid#50867PurposeExpresses human NKCC1 P676C A734C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationP676C A734C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 N672C (NT474)
Plasmid#50873PurposeExpresses human NKCC1 N672C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationN672C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 P676C (NT443)
Plasmid#50877PurposeExpresses human NKCC1 P676C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationP676C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 N731C (NT505)
Plasmid#50885PurposeExpresses human NKCC1 N731C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationN731C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 V673C (NT437)
Plasmid#50874PurposeExpresses human NKCC1 V673C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationV673C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 I677C (NT467)
Plasmid#50878PurposeExpresses human NKCC1 I677C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationI677C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only