We narrowed to 4,389 results for: crispr c plasmids
-
Plasmid#177354PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l from doxycycine-inducible promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterTetracycline-dependent promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-MIR302-3g-EEA-2g-PGK-Puro
Plasmid#201677PurposeEBNA episome plasmid for U6 promoter-driven expression of 3 gRNAs targeting miRNA302/367 (Addgene #201960) and 2 gRNAs targeting EEA-motif (Addgene #102898). Includes PGK-puro selection cassetteDepositorInsertMIR302-3g-EEA-2g-PGK-Puro
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-haA3A-CBE-G-N
Plasmid#220898PurposeAAV genome encoding the N-terminal of haA3A-CBE-GDepositorInserthaA3A-CBE-G-N
UseAAVExpressionMammalianAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-msCAMK2d-sgRNA-cTNT-SaCas9-HA-OLLAS
Plasmid#209782PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA targeted the mouse Camk2d gene by U6 promoterDepositorInsertsgRNA
UseAAVTagsHA and OLLASPromotercTNTAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmZBP1#1
Plasmid#208387PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ZBP1#1 gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmZBP1#2
Plasmid#208388PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ZBP1#2 gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF1a-CRY2PHR-SID4X
Plasmid#63663PurposeAAV expression of CRYS2PHR-SID4XDepositorInsertSID4X-CYR2PHR
UseAAVExpressionMammalianPromoterEF1alphaAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Dot1LCD-CatMut
Plasmid#235591PurposeDox-inducible expression of control catalytic-mutant Dot1l CD fused with scFVDepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Setd2CD-CatMut
Plasmid#235588PurposeDox-inducible expression of control catalytic-mutant Setd2 CD fused with scFVDepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX601‐mhCMV‐miniABEmax‐N3‐ E53ogRNA
Plasmid#187064PurposeNpu Split N-terminal half of ABEmaxNGA with gRNA targeting mdx4cv nonsense mutationDepositorInsertminiABEmax-Npu
UseAAV and CRISPRExpressionMammalianPromotermhCMVAvailable SinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJET-42-DExCon-antiGFPnanobody-mCherry-R11a
Plasmid#179902PurposeDonor with homologous arms for Rab11a to knock in DExCon-antiGFPnanobody-mCherry moduleDepositorInsertRAB11A, member RAS oncogene family (RAB11A Human)
UseCRISPR; Donor for homologous based knock inTagsantiGFPnanobody-mCherryExpressionBacterial and MammalianPromoterTRE3GSAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
Little Prince-enOsCas12f1
Plasmid#251232PurposeDrug inducible gene editing system based on enOsCas12f1 (Little Prince)DepositorInsertH1-TetO-enOsCas12f1 sgRNA scaffold; Core EF1α-opTtetR; enOsCas12f1; NES; StaPLs-TI; 3×BPNLS; GFP
UseAAV and CRISPRExpressionMammalianAvailable SinceJuly 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
Little Prince (TnpB)
Plasmid#251233PurposeDrug inducible gene editing system based on TnpB (Little Prince)DepositorInsertH1-TetO-TnpB ωRNA* scaffold; Core EF1α-opTtetR; TnpB; NES; StaPLs-TI; 3×BPNLS; GFP
UseAAV and CRISPRExpressionMammalianAvailable SinceJuly 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
Little Prince (enIscB)
Plasmid#251234PurposeDrug inducible gene editing system based on enIscB (Little Prince)DepositorInsertH1-TetO-enIscB ωRNA* scaffold; Core EF1α-opTtetR; enIscB; NES; StaPLs-TI; 3×BPNLS; GFP
UseAAV and CRISPRExpressionMammalianAvailable SinceJuly 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS423-TyrSgH
Plasmid#163973PurposeHelper plasmid for cloning gRNAs under the control of the tRNA(Tyr) promoterDepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS423-SgH
Plasmid#163972PurposeHelper plasmid for cloning gRNAs under the control of the SNR52 promoter.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOT_4 - lenti-EFS-FMC6.3-BBz-2A-puro-2A-LTBR
Plasmid#181973PurposeExpresses anti-CD19 CAR (with 4-1BB signaling domain) linked to puromycin resistance via P2A and to human LTBR via T2A for lentiviral delivery.DepositorInsertFMC6.3-BBz CAR; LTBR (LTBR Synthetic, Human)
UseLentiviralAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTarget-TTC
Plasmid#246930Purposefor E.coli plasmid interference and PAM depletion assaysDepositorInsertTTC PAM and GFP-T1 target
UseUnspecifiedAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only