We narrowed to 7,318 results for: gnal
-
Plasmid#41007DepositorInsertEllis van Creveld syndrome 2 (EVC2 Mouse)
TagsFlagExpressionMammalianMutationdeleted amino acids 1177-1220Available SinceNov. 14, 2012AvailabilityAcademic Institutions and Nonprofits only -
HL 3722 (=HL 716 + pHL 404)
Plasmid#30084DepositorInsertpLtetO-1:MicC, pLlacO-1:hfq, pLtetO-1:ompC::gfp
UseSynthetic BiologyTagsGFPExpressionBacterialAvailable SinceSept. 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
XE132 XFz7-CS2P+
Plasmid#16792DepositorInsertXFz7-CS2P+ (fzd7.L Frog)
UseXenopus expressionAvailable SinceMarch 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mEmerald-Sec61b WPRE
Plasmid#236228PurposeAAV expression of a marker for the endoplasmic reticulum, Sec61b, fused to mEmerald.DepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0-MRLC-AA-GFP
Plasmid#187259PurposeLentiviral expression of myosin regulatory light chain-AA mutantDepositorAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJL NarL YdfI Flag
Plasmid#225650PurposeExpresses NarL with a mutated DNA binding domain (YdfI). For use with NarX chimeras and reporter plasmids from this study.DepositorInsertNarL-YdfI (narL Synthetic)
UseCell free expressionTagsFLAGExpressionBacterialMutationNarL with native DNA-binding domain replaced with…PromoterT7Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
Dox-Akt
Plasmid#207328PurposePiggyBac vector backbone encoding doxycycline-inducible expression of membrane-localized Akt1 (without pleckstrin homology domain)DepositorInsertrac protein kinase-alpha (AKT1 Human)
Tagsmyristoylation tag - BFPExpressionBacterialMutationrange: 129 - 480PromoterTet Response ElementAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-EphB4
Plasmid#200983PurposeMammalian expression plasmid for myc-tagged EphB4DepositorInsertEphB4 (EPHB4 Human)
TagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianPromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PDGFRb559-562del-IRES2-EGFP
Plasmid#204355PurposeExpresses a mutant PDGFRb gene (559-562 deletion).DepositorInsertPlatelet derived growth factor receptor beta (PDGFRB) (PDGFRB Human)
Mutation559-562 deletionAvailable SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_DRD1-NTEV-TCS-GV-2xHA
Plasmid#194358PurposeSplit TEV assaysDepositorAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_Paragranulin+linker 1
Plasmid#176915Purposeexpress Paragranulin with linker 1 in mammalian cellsDepositorInsertParagranulin + linker 1 (GRN Human)
TagsTwin-Strep and FLAG tags encoded after Signal Pep…ExpressionMammalianAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGK415-phlTA2-1E
Plasmid#165970PurposeExpresses phlTA(2-1E) mutantDepositorInsertphlF
UseSynthetic BiologyTagsNuclear localization signal and three copies of V…ExpressionYeastMutationP5S, S6P, K86T, F109L, Q117R, E143K, codon-optimi…PromoterpPGK1 mutantAvailable SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2
Plasmid#113945Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutininDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationresidues 22-839PromoterCMVAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 RL23Cm6
Plasmid#109367PurposeHuman rod opsin chimera with intracellular loops 2-3 and C-terminus from mGluR6DepositorAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRRG43-sFRP1
Plasmid#99071PurposedsRNA and riboprobe synthesis for Schmidtea mediterranea sFRP1 (secreted frizzled related protein 1)DepositorInsertsFRP1 (secreted frizzled related protein 1) in situ probe
UseT/a cloning vector for dsrna generation and the g…Available SinceSept. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-retro-puro-tetO-Mek1-shRNA
Plasmid#53179PurposeExpresses shRNA against mouse Mek1 from puromycin resistance retroviral vectorDepositorAvailable SinceJune 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
GRM3 (3SM9)
Plasmid#32870PurposeBacterial expression for structure determination; may not be full ORFDepositorInsertGRM3 (GRM3 Human)
TagsHis tag with TEV cleavage and Honeybee melittin S…ExpressionBacterialAvailable SinceJan. 13, 2012AvailabilityIndustry, Academic Institutions, and Nonprofits -
HL 3904 (=HL 770 + pHL 991)
Plasmid#30093DepositorInsertpLtetO-1:RhyB, pLlacO-1:hfq, pLtetO-1m9:sodB::gfp
UseSynthetic BiologyTagsGFPExpressionBacterialAvailable SinceSept. 9, 2011AvailabilityAcademic Institutions and Nonprofits only -
XE160 XDshHA-pt mutant PDZ-CS2+
Plasmid#16780DepositorInsertDishevelled (dvl2.L Frog)
UseXenopus expressionTagsHAMutationpoint mutation in the binding pocket of the PDZ b…Available SinceMarch 24, 2008AvailabilityAcademic Institutions and Nonprofits only