We narrowed to 27,863 results for: sta
-
Plasmid#46369DepositorAvailable SinceJuly 29, 2013AvailabilityAcademic Institutions and Nonprofits only
-
TFORF1510
Plasmid#144365PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMADM-alpha
Plasmid#36890DepositorInsertsGFP
tdTomato-3Myc
beta-globin intron
Neo
ATG (T)
GFP
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, deleted…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL2
Plasmid#196691PurposeRep/Cap plasmid for the production of PAL2, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPTQGTVR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
3788 pmko-neo A9-1
Plasmid#8878DepositorAvailable SinceJan. 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
3788 pmko-neo A9-3
Plasmid#8880DepositorAvailable SinceJan. 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
HEL binding scFv D44.1
Plasmid#111718PurposeYeast Surface Display of D44.1 as a reference starting point for designDepositorInsertD44.1
Tagscmyc tagExpressionYeastAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMSCV_PIG_3XHA-Ago1
Plasmid#170916PurposeExpresses 3X-HA-AGO1DepositorAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
FLAG-SENP2 C548A
Plasmid#126592PurposeExpresses siRNA resistant SENP2 (catalytic dead) in mammalian cells, Dox inducible in TetR cell linesDepositorAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMP71-tCD19-llo-mc38tmg
Plasmid#174603Purposeexpresses the extracellular and transmembrane domain of murine CD19 with a C terminal fusion of the LLO190 and minigenes of 3 neoantigens from the MC38 tumor in genes ADGPK, DPAGT and Reps1DepositorInsertextracell transmem domains moCD19 wCterm fusion LLO190 and minigenes of 3neoantigens MC38tumor in genes ADGPK DPAGT Reps1
ExpressionMammalianAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_SNORD27h_115mut
Plasmid#73068Purposeexpression clone for human mutated SNORD27 (C/D box snoRNA U27)DepositorInsertSNORD27 (SNORD27 Human)
Tagsno tagExpressionMammalianMutationexpression cassette for SNORD27 with AS box from …Available SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAdTrack shALAS-1
Plasmid#22748DepositorAvailable SinceJuly 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T1-Rpb1-linker
Plasmid#138468PurposeExpresses GST-tagged Rpb1 linker in bacteriaDepositorInsertRpb1 (POLR2A Human)
TagsGSTExpressionBacterialMutationAmino acids 1460-1585PromotertacAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-mu24-ORF24-2xStrep
Plasmid#138453PurposeExpresses mu24-ORF24 chimera with a C-terminal 2xStrep tag in mammalian cellsDepositorInsertmu24-ORF24 (ORF24 MHV68/KSHV)
TagsStrepExpressionMammalianMutationmu24 amino acids 1-191 fused to ORF24 amino acids…PromoterCMVAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
Alt AlphaPS3
Plasmid#14070DepositorInsertDrosphila Alt Alpha PS3 Integrin (scb Fly)
ExpressionBacterialAvailable SinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
TRE3G-ZIM3-Cas9-P2A-GFP
Plasmid#239605PurposeDoxycycline inducible CRISPRgenee constructDepositorAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1as-ZIM3-Cas9-P2A-GFP
Plasmid#239603PurposeConstitutive active CRISPRgenee constructDepositorInsertZIM3 KRAB domain (ZIM3 )
UseCRISPR and LentiviralAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-NF186(K519TAG)-HA
Plasmid#239775PurposeExpresses rat NF186 with a TAG codon at position 519 and a C-terminal HA tag in mammalian cells. Can be used for click labeling.DepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only