-
Plasmid#1182DepositorInserthtt 46Q (HTT Human)
UseTagsGFPExpressionYeastMutationPromoterAvailable sinceAvailabilityAcademic Institutions and Nonprofits only
These results may also be relevant.
-
6MIW
Plasmid#127291PurposeBacterial expression for structure determination. May not contain entire coding region of geneDepositorInsertHUWE1 (HUWE1 Human)
UseTags6xHis-TEV (MHHHHHHSSGRENLYFQG)ExpressionBacterialMutationPromoterT7Available sinceJune 18, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
str-KDEL_Stx5LdeltaER-SBP-mCitrine
Plasmid#154846PurposeSynchronize trafficking of Stx5LdeltaER (M55V) from the ER, for use with FLIM (RUSH system)DepositorInsertStx5 (Long isoform) (STX5 Human)
UseTagsStreptavidin Binding Protein (SBP) and mCitrineExpressionMammalianMutationChanged Methionine 55 to Valine, causes loss of S…PromoterCMVAvailable sinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCB268
Plasmid#53363PurposepcDNA3.0-based plasmid encoding fDHFR-UbK48R-Aβ42 13myc under the control of T7 or CMV promoter for 35S-pulse-chase URT-based assays in rabbit reticulocyte extract.DepositorUseTags13xMyc, Flag, and HAExpressionMammalianMutationPromoterCMVAvailable sinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NLS (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUCIDT-attL1-Worm ABeta-attR5
Plasmid#160437PurposeEntry vector for cloning nematode-codon-optimized Amyloid Beta(1-42) using 2-fragment gateway recombinationDepositorInsertHomo sapiens amyloid beta precursor protein (APP Nematode, Human)
UseTagsCleavage signalExpressionBacterialMutationCodon-optimized for expression in C. elegansPromoterAvailable sinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NES (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
str-KDEL_Stx5L(M55V)-SBP-mCitrine
Plasmid#209846PurposeSynchronize trafficking of Stx5L (M55V) from the ER, for use with FLIM (RUSH system)DepositorInsertSTX5 (STX5 Human)
UseTagsStreptavidin Binding Protein (SBP) and mCitrineExpressionMammalianMutationChanged Methionine 55 to Valine, causes loss of S…PromoterCMVAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
str-KDEL_Stx5S-SBP-mCitrine
Plasmid#154845PurposeSynchronize trafficking of Stx5S from the ER, for use with FLIM (RUSH system)DepositorInsertStx5 (Short isoform) (STX5 Human)
UseTagsStreptavidin Binding Protein (SBP) and mCitrineExpressionMammalianMutationLacks amino acids 1-54, enocdes short isoform of …PromoterCMVAvailable sinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1AUC-DelStem-CD20-Puro
Plasmid#209758PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1; variant 1 mRNA isoform with mutations to disrupt the uORFs and the stem-loop within the 5'-UTR.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationMutations to disrupt the uORFs and the stem-loop …PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
LV2btCRISPRko.v1
Pooled Library#213927PurposeUses lentivirus to deliver the library into hard-to-transduce cellsDepositorExpressionMammalianUseCRISPR and LentiviralAvailable sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
PBbtCRISPRko.v1
Pooled Library#213928PurposeUses the PiggyBac transposon system to deliver the library into hard to transduce cellsDepositorExpressionMammalianUseCRISPR and LentiviralAvailable sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
makeTCR_Hs.TRAV41
Plasmid#233981PurposeHs TRAV gene for makeTCR assemblyDepositorInsertTRAV41 (TRAV41 Human)
UseSynthetic BiologyTagsExpressionMutationPromotern/aAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGWB14-LYX078
Plasmid#126296PurposeWith a Nicotiana benthamiana transcription factor in PGWB14 backbone, for Agrobacterium mediated transient or stable expression corresponding transcription factor fused with a C-terminal HA tag.DepositorInsertNiben101Scf11823g00016.1
UseTagsHAExpressionPlantMutationPromoterCaMV 35SAvailable sinceJune 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pLV-Enh eGFP Reporter-muKC2-X31
Plasmid#59255PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt80-ex5-7
UseLentiviralTagsExpressionMutationPromoterMu Hsp68 minimal promoterAvailable sinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pStA212
Plasmid#114171PurposeStart-Stop Assembly Level 212 plasmidDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pStA1CZ
Plasmid#114166PurposeStart-Stop Assembly Level 1CZ plasmidDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pStA1DZ
Plasmid#114168PurposeStart-Stop Assembly Level 1DZ plasmidDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pStA1DE
Plasmid#114169PurposeStart-Stop Assembly Level 1DE plasmidDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pStA1EZ
Plasmid#114170PurposeStart-Stop Assembly Level 1EZ plasmidDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only