We narrowed to 59,342 results for: cloning
-
Plasmid#230828PurposeAAV cloning vector for Flpo-dependent expression under the TRE promoter.DepositorTypeEmpty backboneUseAAV; Cloning vector, flp/frtAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pBlueKan+cysMPro
Plasmid#187879PurposeEscherichia coli plasmid containing unique cloning sites behind a Campylobacter jejuni cysM promoter. Cloned genes will be expressed from the constitutively expressed C. jejuni promoter.DepositorTypeEmpty backboneExpressionBacterialPromoterCysMAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHBJT017
Plasmid#225168PurposeLow copy cloning vector with same multiple cloning site as pUC19 and pSU19 (AmpR).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceSept. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT024
Plasmid#225175PurposeLow copy cloning vector with same multiple cloning site as pUC18 and pSU18 (SmR).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT023
Plasmid#225174PurposeLow copy cloning vector with same multiple cloning site as pUC19 and pSU19 (SmR).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT019
Plasmid#225170PurposeLow copy cloning vector with same multiple cloning site as pUC19 and pSU19 (TetR).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT020
Plasmid#225171PurposeLow copy cloning vector with same multiple cloning site as pUC18 and pSU18 (TetR).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT021
Plasmid#225172PurposeLow copy cloning vector with same multiple cloning site as pUC19 and pSU19 (GmR).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT022
Plasmid#225173PurposeLow copy cloning vector with same multiple cloning site as pUC18 and pSU18 (GmR).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT016
Plasmid#225167PurposeLow copy cloning vector with same multiple cloning site as pUC18 and pSU18 (ChlR).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT015
Plasmid#225166PurposeLow copy cloning vector with same multiple cloning site as pUC19 and pSU19 (ChlR).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBJT018
Plasmid#225169PurposeLow copy cloning vector with same multiple cloning site as pUC18 and pSU18 (AmpR).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPtPBR11_fcpShble_GWB
Plasmid#154031PurposeGateway cloning into P. tricornutum episomal vectorDepositorTypeEmpty backboneUseDiatom cloningAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTpPBR11_fcpNAT_GWB
Plasmid#154032PurposeGateway cloning into T. pseudonana episomal vectorDepositorTypeEmpty backboneUseDiatom cloningAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBBR1MCS-2
Plasmid#85168PurposeMobilisable shuttle and expression vector. Replicates in many Gram-negative bacteria. Has multiple cloning site with blue/white selection function. Cloned genes driven by derepressed lac promoter.DepositorHas ServiceCloning Grade DNATypeEmpty backboneExpressionBacterialPromoterConstitutive (derepressed P-lac)Available SinceNov. 8, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTpPBR11_accNAT_GWB
Plasmid#154033PurposeGateway cloning into T. pseudonana or C. cryptica episomal vectorDepositorTypeEmpty backboneUseDiatom cloningAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTRE2 EGFP
Plasmid#129435Purposeexpress GFPDepositorInsertGFP
ExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2+TA
Plasmid#49338PurposepCS2+ vector with MCS replaced by a TA-cloning linkerDepositorInsertTA-cloning linker containing EGFP
UseGateway compatible cloning vectorAvailable SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDEST-attB
Plasmid#30325DepositorInsertphiC31 attB site
UseDrosophila transgenesisAvailable SinceOct. 5, 2011AvailabilityAcademic Institutions and Nonprofits only