We narrowed to 25,145 results for: cas9
-
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AC EJ7-GFP
Plasmid#113617PurposeReporter for canonical-NHEJ. Reporter for end joining between two double-strand breaks, induced with the 7a and 7b sgRNAs with CAS9. EJ between the distal ends w/o indel mutations restores GFPDepositorInsertEJ7-GFP variant of EGFP
ExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSMVP-Cas9C-P2A-turboGFP
Plasmid#80935PurposePlasmid that expresses Cas9C in mammalian cells; co-expresses turboGFP.DepositorInsertCas9C
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9D10Anickase.EF1a-BFP.sgLMNApair2
Plasmid#98973PurposeCas9 Homologous Recombination Reporter. SpCas9D10A nickase and a pair of sgRNAs targeting hLMNA. Generates breaks with 96bp 5' overhangs. TagBFP.DepositorInsertLMNA sgRNAs pair 2 and Cas9(D10A)
ExpressionMammalianAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGG422_UV5
Plasmid#165607PurposeVector for expression of the SpCas9 KG variant with sgRNA in E. coli: KG(SpCas9, D1332K/R1333G) and UV5-sgRNA (hEGFP spacer)DepositorInsertlacUV5 driving Streptococcus pyogenes Cas9 KG(D1332K/R1333G) and hEGFP-sgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialMutationD1332K and R1333G mutations in SpCas9PromoterlacUV5 driving Cas9 KG and UV5 driving sgRNAAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
cBEST4
Plasmid#234660PurposeExpresses cytosine base editor - spCas9n (D10A) fused to APOBEC1 and UGI, Include Golden Gate compatible cassette for sgRNA insertionDepositorInsertsspCas9 cytosine base editor
Golden Gate compatible sgRNA insertion cassette
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3 and tcp830Available SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9D10Anickase.EF1a-BFP.sgLMNApair2
Plasmid#98973PurposeCas9 Homologous Recombination Reporter. SpCas9D10A nickase and a pair of sgRNAs targeting hLMNA. Generates breaks with 96bp 5' overhangs. TagBFP.DepositorInsertLMNA sgRNAs pair 2 and Cas9(D10A)
ExpressionMammalianAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330_ATP1A1_G3_Dual_sgRNA
Plasmid#173205PurposeCoselection for HDR in human cells. Vector for dual expression of ATP1A1 G3 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G3 sgRNA + user-specified sgRNA + SpCas9
UseCRISPRExpressionMammalianPromoterDual U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gGFP)-PGKmCherry2AGFP-W
Plasmid#67982PurposeCas9 activity reporter with mCherry and GFPDepositorInsertU6gRNA cassette, PGKmCherry2AGFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPREAvailable SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_LMNA_G2
Plasmid#178090PurposeExpresses the LMNA G2 sgRNA in combination with FLAGless eSpCas9(1.1). This vector can be used in combination with LMNA_mScarlet-I_Donor to tag LMNA with mScarlet-I. pX330-like plasmid.DepositorInsertLMNA G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX458-Dual-Guide-Donor-Cas9-H2B-mCherry
Plasmid#175570PurposeDonor shuttle plasmid to enable ligation of a second U6-GuideRNA casssette into any pX458 family backbone via digestion of both plasmids with XbaI and KpnI.DepositorTypeEmpty backboneUseCRISPRMutationXbaI site added upstream of U6 promotor. G to C …Available SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVMG0212_Cq-nanos-Cas9
Plasmid#169348PurposeExpression of Cas9 in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0212_Cq-nanos-Cas9
UseCRISPRExpressionInsectPromoterCPIJ011551Available SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVMG0173_Cq-Actin5c-Cas9
Plasmid#169345PurposeExpression of Cas9 in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0173_Cq-Actin5c-Cas9
UseCRISPRExpressionInsectPromoterCPIJ009808Available SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVMG0213_Cq-vasa-Cas9
Plasmid#169347PurposeExpression of Cas9 in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0213_Cq-vasa-Cas9
UseCRISPRExpressionInsectPromoterCPIJ009286Available SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-His:dCas9:nls:10P3
Plasmid#135982PurposeExpresses dCas9 fused to 10 copies of the P3 coiled coil in mammalian cellsDepositorInsertdCas9 fused to 10 copies of the P3 coiled-coil
UseCRISPRTagsHisExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterCMVAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTG110
Plasmid#237396PurposePeft-3::Cas9 + ChrIV sgRNADepositorInsertPeft3::Cas9 + ChrIV sgRNA
Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gBFP)-PGKmCherry2ABFP-W
Plasmid#67986PurposeCas9 activity reporter with mCherry and BFPDepositorInsertsU6gRNA cassette, PGKmCherryABFP cassette, WPRE
Guide RNA targeting modified BFP
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVMG0212_Cq-nanos-Cas9
Plasmid#169348PurposeExpression of Cas9 in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0212_Cq-nanos-Cas9
UseCRISPRExpressionInsectPromoterCPIJ011551Available SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVMG0173_Cq-Actin5c-Cas9
Plasmid#169345PurposeExpression of Cas9 in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0173_Cq-Actin5c-Cas9
UseCRISPRExpressionInsectPromoterCPIJ009808Available SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVMG0213_Cq-vasa-Cas9
Plasmid#169347PurposeExpression of Cas9 in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0213_Cq-vasa-Cas9
UseCRISPRExpressionInsectPromoterCPIJ009286Available SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only