We narrowed to 10,831 results for: KIT
-
Plasmid#138772PurposeConstitutive expression of VP16-ZF172 under the CMV promoter.DepositorInsertVP16-ZF172
UseSynthetic BiologyTags3xFlagExpressionMammalianPromoterCMVAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pStrep-2xEGFP-N1
Plasmid#122489PurposeExpression of Strep-tagged 2xEGFPDepositorInsertStrep-tagged 2xEGFP
ExpressionMammalianPromoterCMVAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
EKAR2G_design1_mTFP_105_Venus_157
Plasmid#39819DepositorInsertErk activity reporter
TagsHis-MycExpressionBacterial, Insect, and Mamm…PromoterCMVAvailable SinceJuly 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAS159
Plasmid#194482PurposesynAR CassetteDepositorInsertsynAR Cassette
UseSynthetic BiologyAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAS158
Plasmid#194481PurposesynMR Part (Part 3)DepositorInsertsynMR (Part 3)
UseSynthetic BiologyAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
R6K_tac_GFPmut3_ChInt
Plasmid#187381Purposechromosomal integration downstream of glmS gene via Tn7 system of a cassette containing IPTG-inducible GFPmut3DepositorInsertGFPmut3
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS6
Plasmid#170857PurposeAAV backbone for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of any transgene in neurons under the control of the hSyn1 promoter.DepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIT5_SL
Plasmid#173769PurposeBacterial genomic integration vectorDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceMarch 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
MTK234_033
Plasmid#123996PurposeEncodes the spCas9 sgRNA1 hAAVS1 (site 2) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertsgRNA2 -hAAVS1
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK234_034
Plasmid#123997PurposeEncodes the spCas9 sgRNA1 hAAVS1 (site 3) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertsgRNA3 -hAAVS1
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTRANS_212
Plasmid#91111PurposeTransformation, Type: T-DNA, Plant Selection: 2x35S:hpt II, Viral Replication: ToLCVDepositorTypeEmpty backboneExpressionPlantPromoter35SAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYTK073
Plasmid#65180PurposeEncodes ConRE' as a Type 5 part to be used in the Dueber YTK systemDepositorInsertConRE'
ExpressionBacterialAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYTK079
Plasmid#65186PurposeEncodes HygromycinR as a Type 6 part to be used in the Dueber YTK systemDepositorInsertHygromycinR
ExpressionBacterialAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
p15A-OptoCre-tetA-Ptet-Rtet
Plasmid#189855PurposeCre-inducible activation of tetA for tetracycline resistance.DepositorInsertPtet-loxP-TT-loxP-Rtet-tetA
UseCre/Lox and Synthetic BiologyExpressionBacterialPromoterPtetAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBTK1003 (pSL2)
Plasmid#190998PurposeExpresses red chromoprotein on a broad host range RSF1010 origin plasmidDepositorInsertred chromoprotein
UseSynthetic BiologyExpressionBacterialPromoterCP25Available SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS2-Dreadd-hM3Dq-HA-P2A-tBFP
Plasmid#178707PurposeAAV vector for Cre-dependent transgene expression of Dreadd-hM3Dq-HA-P2A-tBFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertDreadd-hM3Dq-HA-P2A-tBFP
UseAAVPromoterhSynAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHIE046 ZF43x12-C mKate2 (TUPV1)
Plasmid#138726PurposemMoClo TUPV, with ZF43x12-C promoter and mKate2 in the MCSDepositorInsertZF43x12-Compact
UseSynthetic BiologyExpressionMammalianPromoterZF43x12-CompactAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFH113
Plasmid#128210Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU3 promoter module (pFH31)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU3 promoter module (pFH31)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMLS271
Plasmid#73722PurposeSapTrap SNAPtag + Cbr-unc-119 donor plasmidDepositorInsertSnaptag + Cbr-unc-119
UseCRISPR and Cre/LoxExpressionWormAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only