We narrowed to 4,550 results for: erf
-
Plasmid#73435PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3A2.DepositorInsertRepressor 3A2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2v1-sfGFP
Plasmid#145172PurposeMammalian expression plasmid for sACE2-sfGFP high affinity variant 1DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCC_12 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-KRAB-dxCas9NG-NLS-2A-Puro-WPRE
Plasmid#139097PurposeExpresses human codon-optimized inactive xCas9-NG fused to a transcriptional repressor KRAB in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertKRAB-dxCas9-NG
UseCRISPR and LentiviralExpressionMammalianMutationD10A, H840A, A262T,R324L, S409I, E480K, E543D, M6…Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pdCas9 (GB1079)
Plasmid#75399PurposeProvides the human codon optimized CDS of Cas9 protein with mutated (D10A, H840A) and inactivated catalytic domains as a level 0 GoldenBraid part for C-terminal fusionsDepositorInsertCas9 coding region with mutated (D10A, H840A) and inactivated catalytic domains (human codon optimised)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCCL-PGK-SPdCas9-BFP-DNMT3A(E752A)
Plasmid#71213PurposedCas9 fused to BFP and the human DNMT3A catalytically inactive domainDepositorInsertdSpCas9-BFP-DNMT3A(E752A), DNMT3A catalytic domain with inactivation mutation E752A
TagsdSpCas9-BFP-DNMT3A(E752A)ExpressionMammalianAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pETM30-C9ORF78_F8A
Plasmid#193369PurposeExpression of C9ORF78 F8A variant in E.coli with N-terminal His6-GST-tag which is cleavable with TEV proteaseDepositorInsertC9ORF78_F8A (C9orf78 Human)
TagsHis6-GST-TEVExpressionBacterialMutationF8A, the mutation is located in the binding inter…PromoterT7Available SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-tagBFP-hTRF1
Plasmid#103801PurposeBLInCR 'Localizer' construct that marks the telomeres and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4A6
Plasmid#73434PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4A6.DepositorInsertRepressor 4A6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-SMASh-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187949PurposeSMASh degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertSMASh-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2v3-sfGFP
Plasmid#145174PurposeMammalian expression plasmid for sACE2-sfGFP high affinity variant 3DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-C4
Plasmid#73427PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant C4.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2v5-sfGFP
Plasmid#145176PurposeMammalian expression plasmid for sACE2-sfGFP high affinity variant 5DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2v4-sfGFP
Plasmid#145175PurposeMammalian expression plasmid for sACE2-sfGFP high affinity variant 4DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2v2.2-sfGFP
Plasmid#149665PurposeMammalian expression plasmid for sACE2-sfGFP high affinity variant 2.2DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3F2
Plasmid#73428PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3F2.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2-T92Q-sfGFP
Plasmid#145178PurposeMammalian expression plasmid for sACE2-sfGFP glycosylation mutant T92QDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_L436P
Plasmid#234559PurposeCTNNA1 eye phenotype via forward genetic screenDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD M1601E
Plasmid#169828PurposeExpresses C-terminal flag-tagged CAD with mutation at reported dimerization interface of the DHOase domainDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationM1601E; TCCC -> AGTC silent mutations at nt527…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-dSpCas9
Plasmid#201953PurposeMammalian expression plasmid of dead SpCas9 with T2A-EGFP and cloning backbone for sgRNADepositorInsert3xHA-NLS-dSpCas9-T2A-EGFP
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianMutationD10A and H840A on SpCas9PromoterCbhAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only