We narrowed to 6,267 results for: cat.2
-
Plasmid#228234PurposeFor targeted tethering of the catalytic domain of mouse TET2 using dCas13DepositorInsertsUseCRISPRExpressionMammalianMutationCD (cysteine-rich, dioxygenase domain) truncation…PromoterCAGAvailable SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only
-
LentiCRISPR v2 hBAK
Plasmid#129579PurposeCRISPR deletion of human BAKDepositorAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Ptpn23-g1)-PGKpuroBFP-W
Plasmid#105034PurposeLentiviral gRNA plasmid targeting mouse Ptpn23 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Tsc2-g1)-PGKpuroBFP-W
Plasmid#105039PurposeLentiviral gRNA plasmid targeting mouse Tsc2 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Tsc2-g2)-PGKpuroBFP-W
Plasmid#105040PurposeLentiviral gRNA plasmid targeting mouse Tsc2 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX458-sgRNA_Ago1_2
Plasmid#73534PurposeExpresses SpCas9, GFP, and sgRNA targeting Ago1DepositorInsertAGO1
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T Doc2beta C2AB(125) WT
Plasmid#134690PurposeEncodes cytoplasmic domain of Doc2beta for bacterial expression and purificationDepositorAvailable SinceNov. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Zfp219-g1)-PGKpuroBFP-W
Plasmid#105021PurposeLentiviral gRNA plasmid targeting mouse Zfp219 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Ndufa2-g2)-PGKpuroBFP-W
Plasmid#105031PurposeLentiviral gRNA plasmid targeting mouse Ndufa2 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
HOXA5 (human) HIS-tag pET
Plasmid#8562DepositorInsertHOXA5 (HOXA5 Human)
TagsHis and T7ExpressionBacterialMutationSacI site at amino acids 1-2 was used to clone in…Available SinceMay 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCG_IFITM1
Plasmid#179955PurposeExpression vector for human IFITM1.DepositorAvailable SinceFeb. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCG_IFITM2
Plasmid#179956PurposeExpression vector for human IFITM2.DepositorAvailable SinceFeb. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB-3xFlag-dCas13-mTET2HxDCD
Plasmid#228235PurposeFor targeted tethering of an inactive mutant (HxD) of the catalytic domain of mouse TET2 using dCas13DepositorInsertsUseCRISPRExpressionMammalianMutationCD (cysteine-rich, dioxygenase domain) truncation…PromoterCAGAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
7M8
Plasmid#64839PurposeThis plasmid can be used in the triple transfection method of AAV vector production. It supplies the replication proteins from AAV2 and the 7M8 capsid protein.DepositorInsert7M8 cap
UseAAVMutation7mer insertion in the AAV2 capAvailable SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.4_CEACAM6-His
Plasmid#149337Purposefor eukaryotic expression and purification of CEACAM6-His6DepositorInsertCEACAM6 (CEACAM6 Human)
TagsIL-2 signal peptide and polyhistidineExpressionMammalianMutationpoint mutation (GGA to GCA) to replace 'G-g…PromoterCMVAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
scFv-GCN4-DNMT3a(R887E)-DNMT3l
Plasmid#154141PurposeExpresses a higher specificity variant of scFv-GCN4-DNMT3a-DNMT3l, contains R887E mutation in DNMT3a. To be used with the dCas9-SunTag system for targeted DNA methylation.DepositorInsertscFv-GCN4, DNMT3a (catalytic domain), DNMT3l (C-terminal part), sfGFP
TagsHA and sfGFPExpressionMammalianMutationR887EPromoterSFFVAvailable SinceOct. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac Dual α1B/β2B Tubulin
Plasmid#170553PurposeEncodes codon-optimized human α1B and β2B tubulin for expression in and purification from insect cells.DepositorTagsAP linker, GS linker (GGSGG), His10 tag, L21 enha…ExpressionInsectAvailable SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac Dual α1B/β3 Tubulin
Plasmid#170552PurposeEncodes codon-optimized human α1B and β3 tubulin for expression in and purification from insect cells.DepositorTagsAP linker, GS linker (GGSGG), His10 tag, L21 enha…ExpressionInsectAvailable SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
miniABEmax (pRZ900)
Plasmid#131311PurposeCMV promoter expression plasmid for bpNLS-TadA7.10-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS (ABEmax with truncation of WT TadA domain).DepositorInsertbpNLS-TadA7.10-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS
ExpressionMammalianPromoterCMVAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only