We narrowed to 15,924 results for: nar;
-
Plasmid#186674PurposeN-terminal tag cassette with BbsI restriction sites for CRISPR donor plasmid.DepositorInsertMammalian N-terminal Tag
Tags3xFlag-3xHAExpressionMammalianAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV N-SpyCas9-Intein, U6-gRNA scaffold (F+E)
Plasmid#120293PurposeAAV Vector for expression of N-terminal SpyCas9 fragment with Intein and a U6-driven F+E gRNA scaffoldDepositorInsertN-terminal fragment of SpyCas9
UseAAV and CRISPRTagsSV40-NLS and split-inteinExpressionMammalianAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-DHFR F[1,2]-N (TRP1)
Plasmid#177797PurposeGateway destination vector to insert genes of interest having a N-terminal DHFR F[1,2] fusion for DHFR-PCA/BFG-PCA assays.DepositorTypeEmpty backboneTagsDHFR F[1,2]ExpressionYeastPromoterADH1Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBABE MDER
Plasmid#13494DepositorInsertMyoD1-Estrogen Receptor Fusion Protein (Myod1 Mouse, Human)
UseRetroviralExpressionMammalianMutationfull length MyoD was fused to aa282-595 of Esr1. …Available SinceDec. 29, 2006AvailabilityAcademic Institutions and Nonprofits only -
pGEX-UAP56
Plasmid#157661PurposeExpresses UAP56 in E.coli cellDepositorInsertSpliceosome RNA helicase DDX39B (DDX39B Human)
TagsGST tagExpressionBacterialMutationdeleted amino acids 1-43Available SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
AsCas12a-2C-NLS in pCSDest
Plasmid#126637PurposeExpresses AsCas12a-2C-NLS in mammalian cellsDepositorInsertAsCas12a-2C-NLS
UseCRISPRTags3xHuman influenza hemagglutinin (HA)-TagExpressionMammalianPromoterCMV IE94 promoterAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-GST-PolB(WT)
Plasmid#177131PurposeBacterial vector for expression of an N-terminal GST fusion of PolB(WT) with a TEV protease site located between the GST tag and PolB(WT)DepositorAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_alpha2: Pnos:ER:lexABD:GAL4AD:T35s-OplexA:mini35S:phi31:Tnos-Pnos:GR:LacIBD:Gal4AD:Tnos-OplacI:mini35S:RDF:Tnos (GB1679)
Plasmid#160619PurposeModule for estradiol-inducible expression of the PhiC31 integrase gene and dexamethasone -inducible expression of PhiC31 phage recombination directionality factor (RDF) gene.DepositorInsertERLexABDGal4AD / PhiC31 / GRLacIBDGal4AD / RDF
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMS-dsRed2-C1824U LMNA-GFP minigene
Plasmid#128231PurposeC1824U mutation Lamin A splicing reporterDepositorInsertlamin A (LMNA Human)
TagsGFP and SV40-driven dsRed2 to identify transfecte…ExpressionMammalianMutationC1824UPromoterCMVAvailable SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
JE301: pMVP (L5-L4) Tir1-P2A-AID
Plasmid#121722PurposepMVP L5-L4 entry plasmid, contains Tir1-P2A-AID for 4-component MultiSite Gateway Pro assembly. Allows expression of N-term Tir1 linked by P2A to AID domain fused to gene of interest.DepositorInsertosTir1-P2A-AID (open)
UseSynthetic Biology; Pmvp gateway entry plasmidTags9x myc (C-term on osTIR1)Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
CMV-NFIB-T2A-miRFP670
Plasmid#187222PurposeExpresses human NFIB and miRFP670 via T2A linker under control of a CMV promoter.DepositorInsertNuclear Factor I B (NFIB Human)
TagsInserted T2A-miRFP670 at 3' terminal of MCS.ExpressionMammalianPromoterCMVAvailable SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
SOX2-P2A-tagBFP-HDR
Plasmid#163751PurposeHDR knock-in template for tagging the human endogenous SOX2 gene with a tagBFP fluorescent marker linked by a self-cleaving P2A peptide.DepositorInsertSOX2 (SOX2 Human)
UseCRISPR and Synthetic BiologyTagsP2A-tagBFPMutationDoes not contain start codon to avoid random inte…Available SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
KAT6B-Tol2
Plasmid#113384Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of KAT6B geneDepositorInsertKAT6B-enhancer (KAT6B Human)
UseTol2 reporterAvailable SinceSept. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
FnoCas12a-2C-NLS in pCSDest
Plasmid#126639PurposeExpresses FnoCas12a-2C-NLS in mammalian cellsDepositorInsertFnoCas12a-2C-NLS
UseCRISPRTags3xHuman influenza hemagglutinin (HA)-TagExpressionMammalianPromoterCMV IE94 promoterAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMMDS DEST
Plasmid#206264PurposeDEST vector for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. After LR propagate in Pir+. Works as a CRE-donor in the MultiBac system.DepositorTypeEmpty backboneUseCre-donor, multimate/gateway dest vector (multiba…Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWPT-/mEGFP-1T-IRES-mCherry
Plasmid#190190PurposeLentiviral expression vector with altered Kozak sequence to direct EGFP expression. mCherry expression is regulated by an IRES.DepositorInsertsmEGFP
mCherry
UseLentiviralMutationchanged EGFP Kozak sequence inserting a C>T mo…PromoterEIF1-shortAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 1 CMV EYFP Tubulin
Plasmid#206254PurposeENTR Vector 1 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes EYFP Tubulin under the control of CMV promoter.DepositorInsertEYFP Tubulin
UseMultimate/gateway entr 1TagsEYFPExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 2 CMV mTFP1 Actin
Plasmid#206255PurposeENTR Vector 2 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes mTFP1 Actin under the control of CMV promoter.DepositorInsertmTFP1 Actin
UseMultimate/gateway entr 2TagsmTFP1ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 3 CMV mito mCherry
Plasmid#206256PurposeENTR Vector 3 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes mitochondrially localised mCherry under the control of CMV promoter.DepositorInsertmito mCherry
UseMultimate/gateway entr 3TagsCOX8 mitochondrial tagExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only