We narrowed to 1,449 results for: TOX
-
Plasmid#29598DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only
-
426Gal-FUS-1-170aa-YFP
Plasmid#29596DepositorAvailable SinceApril 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-1-413aa-YFP
Plasmid#29599DepositorAvailable SinceJuly 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-101-526aa-YFP
Plasmid#29603DepositorAvailable SinceJuly 20, 2011AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-1-453aa-YFP
Plasmid#29600DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-267-526aa-YFP
Plasmid#29605DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-285-526aa-YFP
Plasmid#29606DepositorAvailable SinceSept. 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-1-270aa-YFP
Plasmid#29597DepositorAvailable SinceJuly 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-368-526aa-YFP
Plasmid#29607DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
RAT +D122H
Plasmid#187426PurposeExpresses Na,K-ATPase (ATP1A1 and ATP1B1 in pFastBac Dual vector) in insect cellsDepositorExpressionInsectMutationchanged aspartic acid at 129 for histidinePromoterPH and p10Available SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
RAT +R111E
Plasmid#187425PurposeExpresses Na,K-ATPase (ATP1A1 and ATP1B1 in pFastBac Dual vector) in insect cellsDepositorExpressionInsectMutationchanged arginine at 118 to glutamic acidPromoterPH and p10Available SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
S+Q111R+N122D
Plasmid#167175PurposeExpresses the full Leptodactylus latrans Na+K+ATPase with ATP1A1-S variant with Q111R and N122D mutations in Sf9 cellsDepositorInsertsATP1A1-S+Q111R+N122D
ATP1B1
ExpressionBacterial and InsectMutationChanged Q at 111 to R and changed N at 122 to DPromoterP10 and PHAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
S+10subs
Plasmid#167176PurposeExpresses the full Leptodactylus latrans Na+K+ATPase with ATP1A1-S variant with 10 R mutations in Sf9 cellsDepositorInsertsATP1A1-S+10R
ATP1B1
ExpressionBacterial and InsectMutationChanged A at 112 to T; E at 116 to D; I at 135 to…PromoterP10 and PHAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
S+12subs
Plasmid#167177PurposeExpresses the full Leptodactylus latrans Na+K+ATPase with ATP1A1-S variant with 12 R mutations in Sf9 cellsDepositorInsertsATP1A1-S+12R
ATP1B1
ExpressionBacterial and InsectMutationChanged Q at 111 to R; A at 112 to T; E at 116to …PromoterP10 and PHAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EWSR1::WT1(-KTS)
Plasmid#220565PurposeLentiviral expression of human EWSR1::WT1(-KTS)DepositorAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EWSR1::WT1(+KTS)
Plasmid#220566PurposeLentiviral expression of human EWSR1::WT1(+KTS)DepositorAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV_HyPer7RgDAAO
Plasmid#217653PurposeExpresses the fusion of HyPer7,a H2O2 sensor, and Rhodotorula gracilis D amino acid oxidase (DAAO) to measure transport of D amino acids across the plasma membraneDepositorInsertHyPer7 D amino acid oxidase
UseLentiviralTagsNuclear export signalExpressionMammalianMutationFused DAAO to the C-terminus of HyPer7 using a Gl…PromoterCMVAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti.DTR.GFP
Plasmid#201962PurposeLentiviral vector that expresses diptheria toxin receptor (DTR) C-terminally fused to EGFPDepositorInsertDiptheria Toxin Receptor
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1alphaAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG303-Gal-PR50
Plasmid#84905Purposeinduce expression of dipeptide repeat PR in yeastDepositorAvailable SinceNov. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER20-Tau
Plasmid#92201PurposeRetroviral overexpression vector (doxycycline-inducible) for TauDepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pIGAhRC
Plasmid#112510Purposehuman Ah receptor and Arnt cDNAs expressed under control of Gal1,10 bidirectional promoterDepositorUseSynthetic BiologyExpressionYeastPromoterGal1,10Available SinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
CHFR-PBZ-eGFP
Plasmid#211581PurposeExpressing CHFR PBZ domain fused to eGFPDepositorInsertCHFR PBZ domain (CHFR Human)
TagseGFPExpressionMammalianMutationPBZ domain of the proteinPromoterCMVAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCVpuro-Mito-Pericam
Plasmid#87381PurposeRetroviral transfection of cells to express ratiometric Pericam as described by Nagai et al 2001 (PMID 11248055) localising to the mitochondrial matrix via the transit peptide from human COX8A.DepositorInsertMito-Pericam [ratiometric]
UseRetroviralExpressionMammalianPromoterRetroviral 5' LTR promoterAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDEST53-LRRK2-3XKD
Plasmid#25049DepositorInsertLRRK2 (LRRK2 Human)
TagsGFPExpressionMammalianMutation"Kinase Dead" Lysine 1906 mutated to A…Available SinceJune 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-Vcan-V3-HA
Plasmid#238076PurposeExpresses Vcan V3 in mice heart tissuesDepositorAvailable SinceAug. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG303-Gal-PA50
Plasmid#84906Purposeinduce expression of dipeptide repeat PA in yeastDepositorAvailable SinceApril 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSN840
Plasmid#184832PurposeExpresses human KIF5A(∆exon27) and human KLC1 in insect cellsDepositorUseCre/LoxTagsHis-FLAG and mScarlet-2xStrepIIExpressionInsectMutation∆exon27 form of human KIF5APromoterp10 and polyhedrinAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG303-Gal-GA50
Plasmid#84907Purposeinduce expression of dipeptide repeat GA in yeastDepositorAvailable SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAG303-Gal-GR100
Plasmid#84908Purposeinduce expression of dipeptide repeat GR in yeastDepositorAvailable SinceNov. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAG416-Gal-PR50
Plasmid#84901Purposeinduce expression of dipeptide repeat PR in yeastDepositorAvailable SinceNov. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAG416-Gal-PA50
Plasmid#84902Purposeinduce expression of dipeptide repeat PA in yeastDepositorAvailable SinceNov. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAG416-Gal-GA50
Plasmid#84903Purposeinduce expression of dipeptide repeat GA in yeastDepositorAvailable SinceNov. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
hSyn-HA-PGRN-LAMP1TM-IRES-GFP
Plasmid#234877PurposeLentiviral plasmid expressing HA-tagged human progranulin that is fused to the transmembrane domain and cytosolic tail of LAMP-1. Enables lysosomal delivery of progranulin without secretion.DepositorInsertProgranulin (GRN Human)
UseLentiviralTagsHA tag and LAMP-1 transmembrane domain and cytoso…ExpressionMammalianPromoterhSYnAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {mCAR}off-{DTR-GFP}on-WPRE
Plasmid#111395PurposeAAV vector with hSynapsin promoter, Cre-OFF mCAR (for efficient CAV-2 infection), Cre-ON DTR-EGFP (diphtheria toxin receptor for cell ablation)DepositorInsertsUseAAVTagsEGFP and MycExpressionMammalianPromoterhSynapsinAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn mCh-IRES-SspB(milli)-BoNT/B(147-441, Y365A)
Plasmid#122985PurposeAAV plasmid with human synapsin promoter driving mCh and SspB(milli)-BoNT/B amino acids 147-441 separated with an IRES element. Co-express with BoNT/B(1-146)-iLID construct for PA-BoNTDepositorInsertmCh-IRES-SspB(milli)-BoNT/B(147-441)
UseAAVTagsmChExpressionMammalianMutationSspB contains A58V,R73Q "milli" mutatio…Promoterhuman synapsinAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE-α-Syn-nYFP
Plasmid#92203PurposeRetroviral overexpression vector for α-Syn bimolecular fluorescence complementation (BiFC)DepositorAvailable SinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {hCAR}off-{DTR-GFP}on-W3SL
Plasmid#111396PurposeAAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection), Cre-ON DTR-EGFP (diphtheria toxin receptor for cell ablation), and W3SL cassette (for maximize cloning capacity)DepositorInsertsUseAAVTagsEGFP and MycExpressionMammalianPromoterhSynapsinAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn mCh-IRES-SspB(micro)-BoNT/B(147-441, Y365A)
Plasmid#122986PurposeAAV plasmid with human synapsin promoter driving mCh and SspB(micro)-BoNT/B amino acids 147-441 separated with an IRES element. Co-express with BoNT/B(1-146)-iLID construct for PA-BoNTDepositorInsertmCh-IRES-SspB(micro)-BoNT/B(147-441)
UseAAVTagsmChExpressionMammalianMutationSspB contains R73Q "micro" mutation, Bo…Promoterhuman synapsinAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-HSD17B11
Plasmid#161923PurposeTo generate HSD17B11 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against HSD17B11 exon 1.DepositorInsertsgRNA targeting HSD17B11 exon 1
UseCRISPRPromoterU6Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST53-LRRK2-3XKD-R1441C
Plasmid#25050DepositorInsertLRRK2 (LRRK2 Human)
TagsGFPExpressionMammalianMutation"Kinase Dead" Lysine 1906 mutated to A…Available SinceJune 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDEST53-LRRK2-3XKD-Y1699C
Plasmid#25051DepositorInsertLRRK2 (LRRK2 Human)
TagsGFPExpressionMammalianMutation"Kinase Dead" Lysine 1906 mutated to A…Available SinceJune 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-WWE-HA-nLuc-FLAG-T2A-WWE-myc-cLuc-FLAG-IRES-Puro
Plasmid#187611PurposeSplit luciferase construct with nLuc fused to C-terminus of WWE domain, linked by T2A to cLuc fused to C-terminus of WWE domain, linked by IRES to puromycin resistance cassetteDepositorInsertsWWE domain with C-terminal nLuc
WWE domain with C-terminal cLuc
UseLentiviralTagsFLAG, HA, Split luciferase (cLuc), Split lucifera…ExpressionMammalianPromoterEF1AAvailable SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-WWE(R163A)-HA-nLuc-FLAG-T2A-WWE-myc-cLuc-FLAG-IRES-Puro
Plasmid#187612PurposeSplit luciferase construct with nLuc fused to C-terminus of WWE domain with Arg163Ala mutation, linked by T2A to cLuc fused to C-terminus of WWE domain, linked by IRES to puromycin resistance cassetteDepositorInsertsWWE domain (R163A) with C-terminal nLuc
WWE domain with C-terminal cLuc
UseLentiviralTagsFLAG, HA, Split luciferase (cLuc), Split lucifera…ExpressionMammalianMutationArg163AlaPromoterEF1AAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-PARP1
Plasmid#211578PurposeCMV driven PARP1-eGFP expressing construct with IRES-Neomycin selectionDepositorAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBABE-Tau-nYFP
Plasmid#92204PurposeRetroviral overexpression vector for Tau bimolecular fluorescence complementation (BiFC)DepositorAvailable SinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBABE-Tau-cYFP
Plasmid#92205PurposeRetroviral overexpression vector for α-Syn/Tau bimolecular fluorescence complementation (BiFC)DepositorAvailable SinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBAD-bARGSer-AxeTxe
Plasmid#192473PurposeSecond-generation bacterial acoustic reporter gene derived from SerratiaDepositorInsertsbARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterNative promoter from Enterococcus faecium and pBADAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-PARP1-Apex2–eGFP
Plasmid#211555PurposeA piggyBac vector containing CMV-PARP1-Apex2-eGFP-IRES-Neo cassette.DepositorAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only