We narrowed to 10,107 results for: transfer
-
Plasmid#82701PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
Plasmid#165493PurposeNeuronal expression of PACmn with dark Venus, a photoactivatable adenylyl cyclase derived from bPAC, membrane-anchored, no/reduced dark activityDepositorInsert2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
UseAAVTagsdarkVenusExpressionMammalianPromoterCaMKIIAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-short Cre-on G/W
Plasmid#86949PurposeGateway destination transfer plasmid for making AAV. Contains a DIO cassette for cre-induction. For introducing large constructs into AAVDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceApril 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-mScarlet-I-Cdt1
Plasmid#191100PurposeTo express a bright monomeric red FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsertmScarlet-I-Cdt1 (30-120)
UseAAV and Synthetic BiologyTagsmScarlet-I fused to residues 30-120 of human Cdt1…ExpressionMammalianMutationOptimized to human codon usagePromoterCMV enhancer and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEMS1996
Plasmid#49126PurposeAAV plasmid with UGT8 (Ple267) promoter driving expression of iCre.DepositorInsertssAAV-Ple267-iCre
UseAAVExpressionMammalianPromoterUGT8Available SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-hSyn-mCherry.3xFLAG.NOS1AP-S-WPRE
Plasmid#127867PurposepAAV plasmid expressing an mCherry.3xFLAG.NOS1AP-S fusion protein under the hSyn promoterDepositorInsertNos1ap (Nos1ap Human, Mouse)
UseAAVTags3xFLAG and mCherryMutationconstructed by blunt end fusion of the 5’ 51 nucl…PromoterhSynAvailable SinceAug. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC814 - pAAV-SYN1-CRTsigpep-GCaMP3 (D324G+D360G+397G+D435G 10.19)-KDEL
Plasmid#63887PurposeAn AAV packaging vector that expresses ER-retained low-affinity GCaMP3 variant under control of the SYN1 promoter.DepositorInsertER-localized low-affinity GCaMP3(10.19)
UseAAVPromoterhuman SYN1Available SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEMS2157
Plasmid#70118PurposePromoterless AAV plasmid with MCS to insert promoter for expression of EmGFP. Contains WPRE.DepositorInsertssAAV-MCS-EmGFP-WPRE
UseAAVExpressionMammalianPromoterPromoterlessAvailable SinceMay 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn1 CaRhAC T2A tDimer
Plasmid#101722Purpose- humanized - variant of pAAV hSyn YFP-CaRhAC Addgene # 101721– less reliable in hippocampal neuronsDepositorInsertsCatRhAC
red fluorescent protein
UseAAVMutationE497K,C569DPromoterhuman Synapsin1 promotor and ribosomal skip seque…Available SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
HT116_pAAV_hSyn-DiO-SomQuasAr6b_EGFP
Plasmid#190879PurposeCre-on expression of soma-targeted QuasAr6b under an neuronal promoterDepositorInsertsoma-targeted QuasAr6b
UseAAVTagsEGFPPromoterhSynAvailable SinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.FAPdL5-POST-T2A-dTomato.FLEX.WPRE.SV40
Plasmid#105982PurposeThis AAV plasmid in the presence of Cre recombinase expresses an extracellular dL5 FAP fused to the neuroligin-1 cytoplasmic domain for targeting to the synapse with a cell fill dTomato.DepositorInsertFLEX-FAPdL5-POST-T2A-dTomato.FLEX
UseAAV and Cre/LoxTagsFAPdL5-POST, T2A-dTomato, and mycExpressionMammalianPromoterhuman synapsin 1Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-CCre-MBP4-WPRE
Plasmid#193919PurposeExpresses one of the components of Cre-DOR_N5C4 (RFP-dependent Cre)DepositorInsertCCre-MBP4
UseAAV, Affinity Reagent/ Antibody, Cre/Lox, and Syn…ExpressionMammalianPromoterEF1aAvailable SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-NCre-MBP5-WPRE
Plasmid#193918PurposeExpresses one of the components of Cre-DOR_N5C4 (RFP-dependent Cre)DepositorInsertNCre-MBP5
UseAAV, Affinity Reagent/ Antibody, Cre/Lox, and Syn…ExpressionMammalianPromoterEF1aAvailable SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAC8_PH-GST-Nter-GWs-Lox (VE5586)
Plasmid#163766PurposeTransfer vector for gene expression to generate recombinant baculoviruses by homologous recombination. Contains expression cassette with an N-ter GST tag under the pH promoter.DepositorInsertN-terminal GST tag
TagsGST TagExpressionInsectPromoterPHAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV2_hSyn_Phobos_Citrine
Plasmid#98216PurposeBlue-shifted artificial anion conducting channelrhodopsin (aACR). Activation max 466 nm; off-kinetics 10 ms. Codon optimized for mammalian expression.DepositorInsertSynthetic construct Phobos gene
UseAAVTagsCitrineExpressionMammalianMutationT59S, E83N, E90Q, E101S, V117R, E123S, T159G, G16…Promoterhuman synapsinAvailable SinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEMS2112
Plasmid#49137PurposeAAV plasmid with NR2E1 (Ple264) promoter driving expression of EmGFP.DepositorInsertssAAV-Ple264-emGFP
UseAAVExpressionMammalianPromoterNR2E1Available SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV2_hSyn_NES-Caprola_04-mEGFP_WRPE-SV40
Plasmid#194688PurposehSyn1 driven expression of the calcium recorder Caprola_04 fused to mEGFP for neuronal expression through AAV transductionDepositorInsertCaprola_04-mEGFP
UseAAVTagsmEGFPPromoterhSyn1Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hGRM1-RFP
Plasmid#22920DepositorInserthuman receptor metabotropic 1 promoter driving DsRedExpress (GRM1 Human)
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pEMS1980
Plasmid#49111PurposePromoterless AAV plasmid with MCS to insert promoter for expression of iCre.DepositorInsertssAAV-MCS-iCre
UseAAVExpressionMammalianPromoterPromoterlessAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits