We narrowed to 16,365 results for: gRNA
-
Plasmid#60967PurposeExpression vector of rat Tyr (wild) guide RNADepositorInsertTyrosinase gRNA
UseCRISPRAvailable SinceJan. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 pegRNA1 with trimmed attP
Plasmid#222346PurposepegRNA 1 plasmid used for PASSIGE-mediated Bxb1 attP installationDepositorInsertAAVS1 attP-installation pegRNA1
UseCRISPRAvailable SinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 pegRNA2 with trimmed attP
Plasmid#222347PurposepegRNA 2 plasmid used for PASSIGE-mediated Bxb1 attP installationDepositorInsertAAVS1 attP-installation pegRNA2
UseCRISPRAvailable SinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-gRNA-CBh-mCherry
Plasmid#91947PurposeExpression of empty gRNA cassette and mCherryDepositorInsertmCherry
UseAAVAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO-sgRNA-puro
Plasmid#104321Purpose3rd generation lentiviral plasmid for inducible expression of sgRNA; derived from tet-pLKO-puro; puromycin selection. See manual for detailed protocols.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterH1/TOAvailable SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gGFP)-PGKBFP2AGFP-W
Plasmid#67980PurposeCas9 activity reporter with BFP and GFP.DepositorInsertU6gRNA cassette, PGKBFP2AGFP cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W
Plasmid#67974PurposeCRISPR gRNA expression vector with an improved scaffold and puro/BFP markersDepositorInsertU6gRNA cassette, PGKpuro2ABFP cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Empty)-PGKBFP2AGFP-W
Plasmid#67979PurposeCas9 activity reporter (control) with BFP and GFP.DepositorInsertU6gRNA cassette, PGKBFP2AGFP cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-DR-SgRNA-DR-EF1a-mCherry-SV40
Plasmid#154002PurposeEmpty SgRNA expression system matching CasRxDepositorInsertSgRNA expression system
UseCRISPRPromoterU6, EF1aAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330GFP-hU6-gRNA-hSpCas9
Plasmid#128385PurposeGFP positive gRNA/hSpCas9 constructDepositorInsertGFP, gRNA and hSpCas9
UseCRISPRAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCas9/VRQR-sgRNA (BbsI)
Plasmid#129725PurposeExpressing SpCas9/VRQR mutant and sgRNA for target sequence with NGA PAMDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
psgRNA-GST-EGFP-GPIDAF
Plasmid#213719PurposeTo express a single-guide RNA under a U6 promoter, accompanied by the expression of the affinity sorting tag GST-EGFP-GPIDAF under a CMV promoter.DepositorInsertEGFP
UseCRISPRTagsGSTPromoterCMVAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-pegRNA-puro backbone
Plasmid#214085PurposeLentiviral backbone plasmid to insert pegRNAs of interest. The cloning site is BsmbI.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterhU6, EF1aAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti U6-sgRNA/EF1a-mCherry
Plasmid#114199PurposeLentivirus compatible SpCas9/dCas9 sgRNA scaffold driven by the U6 promoter and mCherry driven by the EF1a promoterDepositorInsertsgRNA scaffold
UseLentiviralTagsmCherryExpressionMammalianPromoterU6Available SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SpCas9-GFP-U6-gRNA
Plasmid#79144PurposeAll-in-one CRISPR/Cas9 vector with CAG promoter for expression in human ESC/iPSCDepositorInsertSpCas9
UseCRISPRTags2A-GFPExpressionMammalianPromoterCAGAvailable SinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgRNA
Plasmid#124844PurposeVector for Cre-dependent expression of SaCas9DepositorInsertSaCas9, gRNA scaffold
UseAAV, CRISPR, and Mouse TargetingTagsNLS and NLS-3xHAAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA-CMV-GFP
Plasmid#85451PurposeExpress sgRNA in mammalian cellsDepositorInsertpCMV-EGFP
UseAAVPromoterpCMV-EGFPAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKVL2-U6gRNA_SAM(BbsI)-PGKpuroBFP-W
Plasmid#112925PurposeLentiviral vector for SAM-CRISPRa gRNA expression with puroBFPDepositorInserthU6 promoter, gRNA-SAM expression cassette
UseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
FASTHDR-tRNApromo-sgRNA-espCas91_1
Plasmid#167210PurposePlasmid for easy cloning of a sgRNA sequence. The Plasmid contain a tRNA promoter to facilitate the expression of any sgRNA sequence and also expresses eSpCas9(1.1)DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCMVAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only