We narrowed to 14,109 results for: Cre
-
Plasmid#110830PurposeExpresses zinc alpha-2 glycoprotein (ZAG) and dTomato (dT) reporter where both sequences are separated by a T2A self-cleaving peptide sequence as a result, the dT is not fused with the ZAG protein.DepositorAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only
-
Plxna2-AP-His
Plasmid#71997PurposeExpresses the extracellular region of the PlexinA2 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSRP5-bio-His
Plasmid#50805PurposeExpresses enzymatically monobiotinylated full length MSRP5DepositorInsertMSRP5
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…Available SinceFeb. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
SPATR-bio
Plasmid#47782PurposeExpresses enzymatically monobiotinylated full-length SPATR with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised SPATR
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
RON3-bio
Plasmid#47799PurposeExpresses enzymatically monobiotinylated full-length RON3 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised RON3
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
MSP4-bio
Plasmid#47717PurposeExpresses enzymatically monobiotinylated full-length MSP4 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised MSP4
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
KHBD00642
Plasmid#39706DepositorAvailable SinceSept. 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
pLV-REPORT(PGKCMV)-nucTomato-hygro
Plasmid#208573PurposeLV REPORT containing minimal promoter driving monomeric nuclear Tomato followed by an PGK/CMV promoter driving nuclear d2eGFP E2A HygromycinDepositorInsertsmnucTomato
d2nucEGFP
HygroR
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterPGK/CMV and minPAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
GLI1_pLENTI-CAG-IRES-GFP
Plasmid#176992PurposeMammalian lentiviral expression vector encoding GLI1DepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y2B)-PGKpuro2AmCherry-W
Plasmid#163179PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of mCherry tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
BMR1_01g02031-bio-His
Plasmid#108116Purpose[Edit] Expresses enzymatically monobiotinylated full-length BMR1_01g02031 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tagDepositorInsertBMR1_01g02031
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-SVIP-Strep-HA
Plasmid#113491PurposeExpression of human SVIP with C-terminal strep-HA tagDepositorInsertSVIP (SVIP Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
Ncam1_0.0.0-Fc-His
Plasmid#72086PurposeExpresses the extracellular region of the NCAM1, isoform 0.0.0 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
TKTL1
Plasmid#72419PurposeStudy the role of aberrant expression of TKTL1 in HNSCC tumorigenesisDepositorInsertTKTL1 (TKTL1 Human)
ExpressionMammalianMutationmay have one or two synonymous substitutionsPromoterCMVAvailable SinceApril 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
Jam2-Fc-His
Plasmid#72079PurposeExpresses the extracellular region of the JAM-2 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Prohibitin-bio-His
Plasmid#50800PurposeExpresses enzymatically monobiotinylated full length ProhibitinDepositorInsertProhibitin
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable SinceFeb. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
P12p-bio
Plasmid#47726PurposeExpresses enzymatically monobiotinylated full-length P12p ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised P12p
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_0606800-bio
Plasmid#47790PurposeExpresses enzymatically monobiotinylated full-length PF3D7_0606800 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised PF3D7_0606800
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
PD2529 human beta1 full
Plasmid#221401PurposeMammalian expression of human integrin beta1 full-lengthDepositorInsertintegrin beta1 full-length (ITGB1 Human)
TagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and HA …ExpressionMammalianMutationcodon-optimized mature sequenceAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-YOD1-Strep-HA
Plasmid#113483PurposeExpression of human YOD1 with C-terminal strep-HA tagDepositorInsertYOD1 (YOD1 Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSc1
Plasmid#80436PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRExpressionMammalianPromoterCMV and U6Available SinceAug. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLY101-RetroEFS-HER2-28BBz-PRODH2-WPRE
Plasmid#192202PurposeRetro-HER2CAR-PRODH2DepositorAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
GLI1_pcDNA6.2/EmGFP-Bsd
Plasmid#176968PurposeMammalian expression vector encoding GLI1 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLIB_3xFlag-His6-nsp13 (SARS-CoV-2)
Plasmid#169189PurposeBaculoviral transfer vector to express 3xFlag-His6-nsp13 (SARS-CoV-2) in insect cellsDepositorInsert3xFlag-His6-nsp13 (ORF1ab SARS-CoV-2, Synthetic)
Tags3xFlag-His6ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLC-HA active Nedd8-P2A-Hygro
Plasmid#124307PurposeLentiviral vector for expression of HA tagged active or C-terminal cleaved Nedd8-P2A-Hygro casette from a CMV promoterDepositorInsertNedd8 (NEDD8 Human)
UseLentiviralTagsHAExpressionMammalianMutationFive C-terminal amino acids missing compared to w…PromoterCMVAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-PLAA-Strep-HA
Plasmid#113484PurposeExpression of human PLAA with C-terminal strep-HA tagDepositorInsertPLAA (PLAA Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
CMV epArcLight
Plasmid#85803Purposegenetically-encoded fluorescent voltage indicatorDepositorInsertepArcLight
ExpressionMammalianMutationCi-VSP contains R217Q mutation; ecliptic pHluorin…PromoterCMVAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only