We narrowed to 30,163 results for: PLE
-
Plasmid#217699PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRG1 (ADGRG1 Human)
UseTagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-382PromoterAvailable sinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRG2 CTF-FLAG
Plasmid#217700PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRG2 (ADGRG2 Human)
UseTagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-606PromoterAvailable sinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRG4 CTFdeltaTA-FLAG
Plasmid#217735PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRG4 (ADGRG4 Human)
UseTagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-2727PromoterAvailable sinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRG2 CTFdeltaTA-FLAG
Plasmid#217733PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRG2 (ADGRG2 Human)
UseTagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-612PromoterAvailable sinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_EF1a_DIO_HA/FLAG_muMASS_LF
Plasmid#213394PurposeLoss of function variant of uMASS_1 opioid sensor. AAV virus production for Cre dependent expression.DepositorInsertuMASS_LF
UseAAV and Cre/LoxTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_EF1a_DIO_HA/FLAG_muMASS
Plasmid#213393PurposeuMASS_1 opioid sensor. AAV Virus production for Cre dependent expressionDepositorInsertuMASS_1
UseAAV and Cre/LoxTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_HA_Flag-uMASS_LF
Plasmid#209761PurposeAAV virus production for neuonal expression of uMASS (loss-of-function) under hSyn promoterDepositorInsertuMASS_LF
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pS44i8GH-1
Plasmid#207525PurposeConditionally-replicating in Pseudomonas vector, high-copy-number; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→repA, P14b with a translational BCD2 coupler from BG35 (53)→msfGFP; SmR/SpRDepositorInsertoriV(pRO1600/ColE1), xylS, Pm→repA, P14b with a translational BCD2 coupler from BG35 (53)→msfGFP;
UseCRISPR; Pseudomonas vectorTagsExpressionMutationPromoterAvailable sinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-dMASS_LF_WPRE
Plasmid#209766PurposeAAV virus production for neuronal expression of dMASS_LF (loss-of-function) under hSyn promoterDepositorInsertdMASS_LF
UseAAVTagsExpressionMammalianMutationPromoterhSynAvailable sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_HA-Flag-uMASS_1_WPRE
Plasmid#209760PurposeAAV virus production for neuronal expression of uMASS_1 under hSyn promoterDepositorInsertuMASS_1
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-RanGAP*
Plasmid#175237PurposeBacterial expression and purification, low affinity SUMOylation substrate, point mutation F562A reduces affinity for E2, increasing the KmDepositorInsertRANGAP1 (RANGAP1 Human)
UseTagsExpressionBacterialMutationAmino acid 562 F to APromotertacAvailable sinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
mCherry-FKBP-E2
Plasmid#175243PurposeBacterial expression and purification, E2 enzyme (UBC9) for SUMOylation, can be recruited to FRB with rapamycin, CyPet acts as a FRET donor to YpetDepositorInsertUBE2I (UBE2I Human)
UseTagsExpressionBacterialMutationPromoterT7Available sinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
FKBP-EGFP-RanGAP
Plasmid#175236PurposeBacterial expression and purification, high affinity SUMOylation substrate that can recruited to FRB with rapamycinDepositorInsertRANGAP1 (RANGAP1 Human)
UseTagsExpressionBacterialMutationPromotertacAvailable sinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBS-V9
Plasmid#173797PurposepBS plasmid containing aadA gene with 16S rRNA promoter and psbA 3’ region, Silene noctiflora ClpP1 gene with the tobacco regulatory elements and flanking regions for tobacco plastome transformationDepositorInsertsaadA
ClpP1
UseTagsExpressionBacterial and PlantMutationPromoterAvailable sinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBS-V7
Plasmid#173796PurposepBS plasmid containing aadA gene with 16S rRNA promoter and psbA 3’ region, Silene latifolia clpP1 gene with the tobacco regulatory elements and flanking regions for tobacco plastome transformationDepositorInsertsaadA
ClpP1
UseTagsExpressionBacterial and PlantMutationPromoterAvailable sinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBS-V6
Plasmid#173795PurposepBS plasmid containing aadA gene with 16S rRNA promoter and psbA 3’ region, Silene conica clpP1 gene with the tobacco regulatory elements and flanking regions for tobacco plastome transformationDepositorInsertsaadA
ClpP1
UseTagsExpressionBacterial and PlantMutationPromoterAvailable sinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBS-V4
Plasmid#173794PurposepBS plasmid containing aadA gene with 16S rRNA promoter and psbA 3’ region, Nicotiana tabacum clpP1 gene with native regulatory elements and flanking regions for tobacco plastome transformationDepositorInsertsaadA
ClpP1
UseTagsExpressionBacterial and PlantMutationPromoterAvailable sinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pG418R-MCS-LexA-VP16-MiniWhite
Plasmid#165894PurposeG418 resistant LexA driver vector with Mini-w+ CDS eye marker. Enhancer grammar GB20 entry point for custom enhancers. Cut-and-paste cloning can be used. Purple-white bacteria colony screening.DepositorInsertSelectable Empty Enhancer Driver
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -