We narrowed to 2,286 results for: Xpa
-
Plasmid#231335PurposeBEVA Golden Gate cloning vector; Narrow host range plasmid. L1-pMB1-Gm-ELT3; pNDGG021, pOGG009, pNDGG007, pOGG013. GmR.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pQGG003
Plasmid#231330PurposeBEVA Golden Gate cloning vector; BEVA2.0 Narrow host range plasmid with I-SceI counterselectable site for BpiI cloning; KmR/NmR.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-D134*
Plasmid#191110PurposeAn E. coli sfGFP reporter with one TAG at position 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*
Plasmid#191111PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEC2796 (pSpy0C4)
Plasmid#220280Purposeintegrative plasmid for heterologous gene expression in S. pyogenes SF370, integrates into the sagB locus via homologous recombinationDepositorTypeEmpty backboneExpressionBacterialAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMK454 (dTAG-BSD)
Plasmid#214384PurposedTAG for C-terminal taggingDepositorInsertdTAG-BSD
UseCRISPRExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSM045
Plasmid#217399PurposeKmR, pBTRcK broad host range vector with BTE1(C12-specific fatty acid thioesterase codon-optimised for C. necator) under PtrcDepositorInsertBTE1
ExpressionBacterialPromoterPTrcAvailable SinceJuly 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSM046
Plasmid#217400PurposeKmR, pBTRcK broad host range vector with BTE2(C12-specific fatty acid thioesterase codon-optimised for C. necator) under PtrcDepositorInsertBTE2
UseSynthetic BiologyExpressionBacterialPromoterPTrcAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS161
Plasmid#215683PurposeGuide only plasmid targeting chrIII split hygromycinR landing padDepositorInsertU6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS160
Plasmid#215682PurposeGuide only plasmid targeting chrI split hygromycinR landing padDepositorInsertU6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA3.2
Plasmid#208303PurposeExpresses ABE-RA3.2 in mammalian cellsDepositorInsertTadA-RA3.2-SpCas9 D10A
ExpressionMammalianMutationE27D, P48A, R51H, D108G, K110R, A114V, H122R, M12…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA3.3
Plasmid#208304PurposeExpresses ABE-RA3.3 in mammalian cellsDepositorInsertTadA-RA3.3-SpCas9 D10A
ExpressionMammalianMutationE27D, R47K, P48A, R51H, I76F, D108G, K110R, A114V…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA4.0
Plasmid#208305PurposeExpresses ABE-RA4.0 in mammalian cellsDepositorInsertTadA-RA4.0-SpCas9 D10A
ExpressionMammalianMutationP48A, R51H, I76F, A106V, D108G, K110R, T111H, D11…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
FB406
Plasmid#203627PurposePromoter of the TAKA-amylase A gene from A. oryzae, maltose/starch-inducible.DepositorInsertPamyB
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB408
Plasmid#203629PurposePromoter of the ubiquitin ligase gene from P. digitatum (PDIG_07760).DepositorInsertP07760
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB367
Plasmid#203630PurposeModule for the expression of geneticin resistance and Nanoluciferase.DepositorInsertPgpdA:Nluc:Ttub::PtrpC:nptII:Ttub
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB273
Plasmid#203612PurposeTerminator of pyr4 gene from T. reesei.DepositorInsertTpyr4
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB293
Plasmid#203613PurposeAssembly of the transcriptional unit for the auxotrophy marker pyr4 from T. reseei.DepositorInsertTU_pyr4
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB359
Plasmid#203614Purpose5' upstream region of pyrG gene in P. digitatum.DepositorInsert5' upstream Pdig pyrG
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB361
Plasmid#203615Purpose3' downstream region of pyrG gene in P. digitatum.DepositorInsert3' downstream Pdig pyrG
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only