Skip to main content

We narrowed to 23,491 results for: CRISPR

Showing: 4801 - 4820 of 23491 results
  1. GFP-itis pBE-nt

    Plasmid
    #195343
    Purpose
    Base editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNA
    Depositor
    Inserts
    ecTadA(8e)-SpCas9-NG
    gRNA gtgcacgacgccgtatgcga
    Use
    CRISPR
    Mutation
    SpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…
    Promoter
    Lac and ProC
    Available Since
    Jan. 31, 2023
    Availability
    Academic Institutions and Nonprofits only
  2. MSP680

    Plasmid
    #65772
    Purpose
    Human expression vector for SpCas9 EQR variant: CMV-T7-humanSpCas9(D1135E/R1335Q/T1337R)-NLS-3xFLAG (EQR variant)
    Depositor
    Insert
    mammalian codon-optimized Streptococcus pyogenes Cas9 (D1135E/R1335Q/T1337R)-NLS-3XFlag
    Use
    CRISPR
    Tags
    3x FLAG and NLS
    Expression
    Mammalian
    Mutation
    D1135E, R1335Q, and T1337R mutations in Cas9
    Promoter
    CMV & T7
    Available Since
    June 22, 2015
    Availability
    Academic Institutions and Nonprofits only
  3. MSP2133

    Plasmid
    #72249
    Purpose
    Human expression plasmid for SpCas9-HF4 variant: CMV-T7-humanSpCas9-HF4(Y450A, N497A, R661A, Q695A, Q926A)-NLS-3xFLAG
    Depositor
    Insert
    mammalian codon-optimized Streptococcus pyogenes Cas9 HF4(Y450A/N497A/R661A/Q695A/Q926A)-NLS-3xFlag
    Use
    CRISPR
    Tags
    3x FLAG and NLS
    Expression
    Mammalian
    Mutation
    Y450A, N497A, R661A, Q695A, and Q926A
    Promoter
    CMV
    Available Since
    Jan. 6, 2016
    Availability
    Academic Institutions and Nonprofits only
  4. MSP2135

    Plasmid
    #72248
    Purpose
    Human expression plasmid for SpCas9-HF2 variant: CMV-T7-humanSpCas9-HF2(N497A, R661A, Q695A, Q926A, D1135E)-NLS-3xFLAG
    Depositor
    Insert
    mammalian codon-optimized Streptococcus pyogenes Cas9 HF2(N497A/R661A/Q695A/Q926A/D1135E)-NLS-3xFlag
    Use
    CRISPR
    Tags
    3x FLAG and NLS
    Expression
    Mammalian
    Mutation
    N497A, R661A, Q695A, Q926A, and D1135E
    Promoter
    CMV
    Available Since
    Jan. 6, 2016
    Availability
    Academic Institutions and Nonprofits only
  5. dpYPQ230-D156R-ABE8

    Plasmid
    #195569
    Purpose
    dLbCas12a-D156R based adenine base editor, ecTadA8e fused to the N terminal of dLbCas12a-D156R with the linker of (GSAGSAAGSGEF)x3
    Depositor
    Insert
    ecTadA8e-(GSAGSAAGSGEF)x3-dLbCas12a-D156R
    Use
    CRISPR; Gateway compatible ectada8e-(gsagsaagsgef…
    Tags
    5' and 3' NLS
    Expression
    Plant
    Promoter
    ZmUBI1
    Available Since
    May 17, 2023
    Availability
    Academic Institutions and Nonprofits only
  6. pScRad52-SpCas9 (pXK-1646)

    Plasmid
    #208823
    Purpose
    CRISPR/Rad52-Cas9 expression vector for Animal gene editing, harboring the ScRad52-SpCas9 and a VEGFA.gRNA expression cassette. Key Construct: hU6-VEGFa.gRNA-CMV-ScRad52-SpCas9.
    Depositor
    Type
    Empty backbone
    Use
    CRISPR; Cas9
    Tags
    Rad52
    Expression
    Mammalian
    Promoter
    CMV
    Available Since
    Dec. 19, 2023
    Availability
    Academic Institutions and Nonprofits only
  7. pYPQ-dpcoCas9-Act3.0

    Plasmid
    #158408
    Purpose
    CRISPR-Act3.0 system containing dpcoCas9-VP64 fusion protein, T2A linked MS2-SunTag fusion protein, and ScFv-sfGFP-2xTAD activator.
    Depositor
    Insert
    dpcoCas9-VP64-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
    Use
    CRISPR
    Expression
    Plant
    Available Since
    June 25, 2021
    Availability
    Academic Institutions and Nonprofits only
Showing: 4801 - 4820 of 23491 results