We narrowed to 16,346 results for: GRN;
-
Plasmid#218527PurposesgRNA targeting human EIF2AK2/PKRDepositorInsertEIF2AK2 (EIF2AK2 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS79 (eft-3p::Cas9 + sgRNA)
Plasmid#154839PurposeCas9 + sgRNA plasmid that is targeted to the synthetic guide sequence GGACAGTCCTGCCGAGGTGGDepositorInsertsgRNA
UseCRISPRExpressionWormAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCR8-PspCas13b_gRNA[ccdbCam]_1xMS2b
Plasmid#196847Purposebackbone for gRNA cloning of dpspCas13b tagged by 1xMS2DepositorTypeEmpty backboneUseCRISPRAvailable SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKVL2-U6gRNA_SAM(BbsI)-PGKpuroBFP-W
Plasmid#112925PurposeLentiviral vector for SAM-CRISPRa gRNA expression with puroBFPDepositorInserthU6 promoter, gRNA-SAM expression cassette
UseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
7b sgRNA for EJ7-GFP reporter
Plasmid#113624PurposesgRNA/CAS9 expression plasmid to induce the 3’ double-strand break in the EJ7-GFP reporterDepositorInsert7b sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV sgRNA-Notch1 #1 GFP
Plasmid#106950PurposeLentivirus encoding sgRNA targeting murine Notch1. Includes GFP marker.DepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV sgRNA-Hic1 GFP
Plasmid#106953PurposeLentivirus encoding sgRNA targeting murine Hic1. Includes GFP marker.DepositorInsertanti-Hic1 sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK3/PERK_sgRNA
Plasmid#218666PurposesgRNA targeting human EIF2AK3/PERKDepositorInsertEIF2AK3 (EIF2AK3 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-U6-sgRNA-CMV-puro
Plasmid#169450Purposebackbone for sgRNA expressionDepositorInsertsgRNA
UseLentiviralAvailable SinceAug. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
1179_pAAV-U6-BbsI-gRNA-CB-EmGFP
Plasmid#89060PurposeAAV-gRNA cloning vector with GFP reporterDepositorInsertEmGFP
UseAAV and CRISPRExpressionMammalianPromoterChicken beta actin with partial CMV enhancerAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK1/HRI_sgRNA
Plasmid#218529PurposesgRNA targeting human EIF2AK1/HRIDepositorInsertEIF2AK1 (EIF2AK1 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g3)-PGKpuroBFP-W
Plasmid#211984PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g7-5)-PGKpuroBFP-W
Plasmid#211985PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-sp-sgRNA-RNF2_+41nick
Plasmid#135958PurposeS. pyogenes sgRNA for +41 nick in RNF2DepositorInsertRNF2_+41 nicking sgRNA
ExpressionMammalianMutationSee manuscriptPromoterU6Available SinceJan. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT7-[BsaI_cassette]-SpCas9_sgRNA_scaffold (MSP3485)
Plasmid#140082PurposeEntry cloning vector for in vitro transcription or expression of SpCas9 sgRNAs from a T7 promoterDepositorInsertpT7-[BsaI_cassette]-SpCas9_sgRNA_scaffold (MSP3485)
UseIn vitro transcription (mrna synthesis)ExpressionBacterialPromoterT7Available SinceOct. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1 double gRNAs
Plasmid#162791PurposeMultiplex Guide RNAs to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_epegRNA_entry-mpknot_(LM1140)
Plasmid#228253PurposepU6 entry plamid for cloning prime editor mpknot epegRNAs (requires BsmBI or Esp3I digest and ligation of duplexed oligos)DepositorInsertmpknot entry plasmid backbone for epegRNA expression via human U6 promoter
ExpressionMammalianMutationn/aPromoterU6Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Empty)-PGKmCherry2ABFP-W
Plasmid#67985PurposeCas9 activity reporter (control) with mCherry and BFPDepositorInsertU6gRNA cassette, PGKmCherryABFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-U6-sgRNA-BFP-Puro
Plasmid#229014PurposePerturb Seq lentiviral sgRNA vectorDepositorTypeEmpty backboneUseLentiviralAvailable SinceMay 20, 2025AvailabilityAcademic Institutions and Nonprofits only