We narrowed to 6,423 results for: org
-
Plasmid#200144PurposeType 4a part for Modular Cloning in YeastDepositorInsertsfGFP1-10
UseSynthetic BiologyExpressionBacterialAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
DS-ST1cas
Plasmid#48647PurposeBacterial S. thermophilus #1 Cas9 (ST1) + tracrRNA expression, cloDF13/spectinomycinDepositorInsertsCas9
ST1 tracrRNA
UseCRISPRPromoterproCAvailable SinceNov. 21, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AP.Agmat.1-GCaMP7f-WPRE
Plasmid#211492Purposeexpression of GCaMP7f under artificial promoter AgmatDepositorInsertGCaMP7f
UseAAVExpressionMammalianAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR BFP-guide1
Plasmid#118157PurposeCRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA1 against the BFP CDSDepositorInsertKRAB-dCas9-P2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterEF1a core and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-PRDM9
Plasmid#222565PurposePiggyBac transposon plasmid for doxycycline inducible expression of PRDM9DepositorInsertPRDM9 (PRDM9 Human)
ExpressionMammalianAvailable SinceAug. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJKR-L-ttgR
Plasmid#62566PurposeFlavonoid biosensor. Low copy plasmid that expresses GFP proportional to flavonoid concentration.DepositorInsertGFP
ExpressionBacterialAvailable SinceAug. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cas9m2-VP64
Plasmid#47317PurposeCas9m2 ActivatorDepositorInsertCas9m2-VP64
UseCRISPRAvailable SinceAug. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
reporter-gT2
Plasmid#47321PurposeTF reporter for gRNA-AAVS1_T2 (RNA-guided dTomato expression)DepositorInsertminCMV-dTomato_pA
UseCRISPRAvailable SinceAug. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
LHPP
Plasmid#39043PurposeBacterial expression for structure determination; may not be full ORFDepositorInsertLHPP (LHPP Human)
TagsHis TevExpressionBacterialMutationSurface mutant for crystallization: Q58K59 -> …Available SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
dSp-VP64-RTA
Plasmid#99675PurposeExpresses dSp Cas9 fused at C term. To VP64 and RTA activation domainsDepositorArticleInsertdCas9
TagsVP64-RTAExpressionMammalianMutationdead Cas9Available SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
Cas9m3-VP64
Plasmid#47318PurposeCas9m3 ActivatorDepositorInsertCas9m3-VP64
UseCRISPRAvailable SinceAug. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-ST1-A
Plasmid#48665PurposeBacterial ST1 repression YFP reporter: protospacer ADepositorInsertST1 prototspacer A/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pT7-stl
Plasmid#51721Purposeconditional gene knockdowns in Trypanosoma bruceiDepositorTypeEmpty backboneUseConditional gene knockdown in t. bruceiPromoterT7 (2X)Available SinceMarch 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TB
Plasmid#48654PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-ST1-B
Plasmid#48662PurposeBacterial ST1 repression YFP reporter: protospacer BDepositorInsertST1 prototspacer B/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PGK-LAMP1-AlfaTag-APEX2
Plasmid#253244PurposeExpress LAMP1 fused to APEX2 peroxidase to map the spatial organization of the lysosomal membrane and its associated proteins. LAMP1 is also fused to AlfaTag for IF or WB detection.DepositorAvailable SinceMay 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
PTGR-PS2-SpyTAG
Plasmid#237443PurposeExpressing PS2 (SpyTAG) S-layer from C. glutamicum under its native promoterDepositorInsertcpsB-SpyTAG
TagsSpyTAGExpressionBacterialAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaNL
Plasmid#216911PurposeMega' with knockout of GvpN and GvpLDepositorInsertMega' with knockout of GvpN and GvpL
ExpressionBacterialAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaRLS
Plasmid#216955PurposeMega' with knockout of GvpR, GvpL and GvpSDepositorInsertMega' with knockout of GvpR, GvpL and GvpS
ExpressionBacterialAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only