-
Plasmid#112719PurposeAn AAV vector that expresses SpCas9 nickase under a neuronal cell promoterDepositorInsertSpCas9
UseAAVTagsExpressionMutationD10APromoterMecp2Available sinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
Plasmid#213969PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinaseDepositorInsertShank3 sgRNA
UseAAV and CRISPRTagsExpressionMutationPromoterAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1012 - pAAV EF1a DIO Nuc-eYFP
Plasmid#75082PurposeAn AAV packaging vector that expresses Cre-dependent nuclear-localized eYFP under control of the EF1a promoter.DepositorInsertNuc-eYFP
UseAAV and Cre/LoxTagsNLSExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC710 - pAAV EF1a DIO Mem-AcGFP
Plasmid#75081PurposeAn AAV packaging vector that expresses Cre-dependent membrane-localized AcGFP under control of the EF1a promoter.DepositorInsertMem-AcGFP
UseAAV and Cre/LoxTagsPalmitylation siteExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(AAVS1)-PGKpuroBFP-W
Plasmid#200503PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and AAVS1DepositorUseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-JEDI-2P-WPRE
Plasmid#179464PurposeGenetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for neuron -specific expression using the promoter hSynDepositorHas ServiceAAV9InsertJEDI-2P
UseAAVTagsExpressionMammalianMutationPromoterhSynAvailable sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-JEDI-2P-Kv-WPRE
Plasmid#179465PurposeSoma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for expression in excitatory glutamatergic neurons using the promoter CaMKIIDepositorInsertJEDI-2P-Kv
UseAAVTagsExpressionMammalianMutationPromoterCaMKIIaAvailable sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-JEDI-2P-Kv-WPRE
Plasmid#179463PurposeSoma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for neuron -specific expression using the promoter hSynDepositorHas ServiceAAV9InsertJEDI-2P-Kv
UseAAVTagsExpressionMammalianMutationPromoterhSynAvailable sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GCaMP 6m-p2A-ChRmine-Kv2.1-WPRE
Plasmid#131004Purposebicistronic AAV vector to express GCaMP6m and soma-targeted ChRmine under the control of human Synapsin promoterDepositorHas ServiceAAV8InsertChRmine
UseAAVTagsKv2.1-HAExpressionMutationPromoterhSynAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {hCAR}off-{GCaMP6f}on-W3SL
Plasmid#111394PurposeAAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection), Cre-ON GCaMP6f (ultrasensitive calcium sensor), and W3SL regulatory cassette (for maximize cloning capacity)DepositorInsertsUseAAVTags6xHis, Myc, T7, and XpressExpressionMammalianMutationPromoterhSynapsinAvailable sinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_NES-his-CaMPARI2-F391W-G395D-WPRE-SV40
Plasmid#101063PurposeAAV vector expressing CaMPARI2_F391W-G395D (Kd = 530nM), a photoconvertible fluorescent protein-based calcium integrator, in neuronsDepositorInsertCaMPARI2_F391W-G395D
UseAAVTagsFLAG-HA-myc and NES_hisExpressionMutationPromoterhsyn (synapsin-1)Available sinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOTTC292 - pAAV EF1a floxed hChR2(H134R)-EYFP
Plasmid#50834PurposeAn AAV packaging vector that expresses channel rhodopsin 2 (H134R) (fused to EYFP) under the EF1a promoter, which can be deactivated (deleted) by recombination between the flanking loxP sites.DepositorInserthChR2 (H134R)
UseAAV and Cre/LoxTagsEYFPExpressionMammalianMutationH134RPromoterEF1aAvailable sinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1664 - pAAV SYN1 mGas6(delta)-Myc-DDK
Plasmid#202541PurposeAn adeno-associated viral vector expressing murine Gas6 with deletion of (F50-E275) fused Myc and DDK epitopes from a synapsin promoterDepositorInsertGas6 (Gas6 Mouse)
UseAAVTagsMyc-DDKExpressionMutationDeletion of F50-E275PromoterSYN1Available sinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {mCAR}off-{DTR-GFP}on-WPRE
Plasmid#111395PurposeAAV vector with hSynapsin promoter, Cre-OFF mCAR (for efficient CAV-2 infection), Cre-ON DTR-EGFP (diphtheria toxin receptor for cell ablation)DepositorInsertsUseAAVTagsEGFP and MycExpressionMammalianMutationPromoterhSynapsinAvailable sinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIA4-2xmiR-122 target sites
Plasmid#120298PurposeAAV vector for expression of AcrIIA4 with two miR-122 binding sitesDepositorInsertAcrIIA4-2xmiR-122 binding sites
UseAAV and CRISPRTagsFLAGExpressionMammalianMutationPromoterAvailable sinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1534 pscAAV mU6 shRNA(PKCd) CMV-IE Nuc-EYFP
Plasmid#135562PurposeAn AAV vector expressing shRNA vs rat PKCd and a nuclear EYFP reporterDepositorInsertsshRNA (mouse PKCd)
Nuc-EYFP
UseAAV and RNAiTags3xNLSExpressionMammalianMutationPromoterCMV-IE and mU6Available sinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV Intein-C-SpyCas9, CMV-AcrIIA4-scaffold (2xBsmBI sites)
Plasmid#120294PurposeAAV Vector for expression of C-terminal SpyCas9 fragemnt with split-intein and a CMV-driven AcrIIA4 (no miR binding sites)DepositorInsertC-terminal fragment of SpyCas9
UseAAV and CRISPRTagssplit-inteinExpressionMammalianMutationPromoterAvailable sinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1535 pscAAV mU6 shRNA(scram) CMV-IE Nuc-EYFP
Plasmid#135563PurposeAn AAV vector expressing scrambled shRNA and a nuclear EYFP reporterDepositorInsertsshRNA (scrambled)
Nuc-EYFP
UseAAV and RNAiTags3xNLSExpressionMammalianMutationPromoterCMV-IE and mU6Available sinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-GCaMP6f
Plasmid#135632PurposeAAV vector to drive the expression of GCaMP6f in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertGCaMP6f
UseAAVTagsExpressionMutationNonePromoterAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-E29-ChR2GFP2x
Plasmid#153437PurposeAAV vector to drive the expression of dChr2-GFP-P2A-GFP in PV cortical interneuronsunder the control of the E29 regulatory elementDepositorInsertChr2-GFP-P2A-GFP
UseAAVTagsExpressionMutationPromoterAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-E22-ChR2GFP2x
Plasmid#153436PurposeAAV vector to drive the expression of dChr2-GFP-P2A-GFP in PV cortical interneuronsunder the control of the E22 regulatory elementDepositorInsertChr2-GFP-P2A-GFP
UseAAVTagsExpressionMutationPromoterAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-E11-ChR2GFP2x
Plasmid#153434PurposeAAV vector to drive the expression of dChr2-GFP-P2A-GFP in PV cortical interneuronsunder the control of the E11 regulatory elementDepositorInsertChr2-GFP-P2A-GFP
UseAAVTagsExpressionMutationPromoterAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-E14-ChR2GFP2x
Plasmid#153435PurposeAAV vector to drive the expression of dChr2-GFP-P2A-GFP in PV cortical interneuronsunder the control of the E14 regulatory elementDepositorInsertChr2-GFP-P2A-GFP
UseAAVTagsExpressionMutationPromoterAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOTTC814 - pAAV-SYN1-CRTsigpep-GCaMP3 (D324G+D360G+397G+D435G 10.19)-KDEL
Plasmid#63887PurposeAn AAV packaging vector that expresses ER-retained low-affinity GCaMP3 variant under control of the SYN1 promoter.DepositorInsertER-localized low-affinity GCaMP3(10.19)
UseAAVTagsExpressionMutationPromoterhuman SYN1Available sinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-iGluSnFR4s-NGR-WPRE
Plasmid#234437PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-NGR
UseAAVTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianMutationPromoterSynapsinAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-iGluSnFR4s-NGR-WPRE
Plasmid#234451PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-NGR
UseAAVTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianMutationPromoterCAGAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-iGluSnFR4f-NGR-WPRE
Plasmid#234452PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-NGR
UseAAVTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianMutationPromoterCAGAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-iGluSnFR4f-NGR-WPRE
Plasmid#234438PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-NGR
UseAAVTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianMutationPromoterSynapsinAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-iGluSnFR4f-PDGFR-WPRE
Plasmid#234436PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianMutationPromoterSynapsinAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-iGluSnFR4s-PDGFR-WPRE
Plasmid#234435PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianMutationPromoterSynapsinAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-iGluSnFR4s-PDGFR-WPRE
Plasmid#234445PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianMutationPromoterGFAPAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-iGluSnFR4f-PDGFR-WPRE
Plasmid#234446PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianMutationPromoterGFAPAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-iGluSnFR4f-PDGFR-WPRE
Plasmid#234450PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianMutationPromoterCAGAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-iGluSnFR4s-PDGFR-WPRE
Plasmid#234449PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianMutationPromoterCAGAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMV2 AAV-RapaInducible-NFZ-HGF
Plasmid#188749PurposeRapamycin inducible AAV vector expressing HGFDepositorInsertHGF (HGF Human)
UseAAVTagsExpressionMammalianMutationPromoterRapamycin inducibleAvailable sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1079 - pAAV TH gRNA A EF1a EGFP
Plasmid#113159PurposeAn AAV vector that expresses guide RNA targeting rat TH and expresses EGFP reporterDepositorInsertgRNA for rat TH
UseAAV and CRISPRTagsExpressionMammalianMutationPromotermU6Available sinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn1-GRAB-HTR6-cilia
Plasmid#189615PurposeExpresses cilia-targeted serotonin sensor based on HTR6 receptor and cpEGFP, driven by SYN promoterDepositorInsertHTR6_GRAB
UseAAVTagsExpressionMutationPromoterSyn1Available sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.iGluSnFR3.v857.IgK-NGR
Plasmid#196227PurposeFluorescent reporter for glutamate, third generation, variant 857 in NGR backbone. iGluSnFR3.v857.NGRDepositorInsertpAAV hSyn iGluSnFR3 v857.NGR
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and NGR TM DomainExpressionMammalianMutationPromoterAvailable sinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only