We narrowed to 7,759 results for: Trac;
-
Plasmid#158397PurposeGolden Gate entry vector to express the 5th gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterWithout promoterAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pYPQ136-tRNA2.0
Plasmid#158398PurposeGolden Gate entry vector to express the 6th gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterWithout promoterAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDAI-SceI-SacB
Plasmid#113635PurposeBroad host range replicative plasmid expressing the I-SceI homing endonuclease and the counterselectable marker SacBDepositorInsertsacB
ExpressionBacterialMutationPlease see Depositor CommentsPromotersacB promoterAvailable SinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCSIIhyg-rtTA
Plasmid#139480PurposeExpresses rtTA, Tet-ON reverse tetracycline-controlled trans-activator in mammalian cells.DepositorInsertrtTA, Tet-ON reverse transactivator
UseLentiviralExpressionMammalianPromoterHuman EF1a promoterAvailable SinceMarch 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCW-Cas9-2A-EGFP
Plasmid#167928PurposeDoxycycline-inducible Cas9 expression tracked by EGFP fluorescence marker.DepositorInsertT2A-EGFP
UseCRISPR and LentiviralExpressionMammalianPromotertTRE, hPGKAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLPCX-NICD
Plasmid#44471DepositorInsertNotch intracellular domain (Notch1 Mouse)
UseRetroviralTagsMycExpressionMammalianMutationContains amino acid 1753 to C-TermPromoterCMVAvailable SinceMay 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
-
pLARRYv2-EGFP
Plasmid#233208PurposeCloning expressed barcodes at the EcoRV site for preparing lentiviral libaries for single-cell lineage tracing experiments, with EGFP markerDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDSW1728
Plasmid#120812PurposeE. coli-C. difficile shuttle vector: tetracycline-inducible promoter (Ptet) driving expression of red fluorescent protein (mCherryOpt)DepositorInsertred fluorescent protein (mCherry), codon-optimized for C. difficile
ExpressionBacterialPromoterPtetAvailable SinceFeb. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRDA_118
Plasmid#133459PurposeU6 promoter expresses customizable Spyo-guide; EF1a promoter provides puromycin resistance. This vector is a derivative of the lentiGuide vector, with minor modifications to the tracrRDepositorInsertcontrol guide
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132B2.0
Plasmid#99888PurposeGolden Gate entry vector to express the 2nd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131B2.0
Plasmid#99885PurposeGolden Gate entry vector to express the 1st gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-2_PolyU(1)_Tornado-Corn
Plasmid#159487PurposeTests for the impact of 1 uracil in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-2_PolyU(1)
ExpressionMammalianPromoterU6-27Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLARRYv2-T-Sapphire
Plasmid#233209PurposeCloning expressed barcodes at the EcoRV site for preparing lentiviral libaries for single-cell lineage tracing experiments, with T-Sapphire markerDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-hM3Dq-mCherry
Plasmid#166599PurposeEncodes Cre-dependent hM3Dq-mCherry under control of the TREDepositorInserthM3Dq-mCherry
UseAAVPromotertetracycline response elementAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
Flag-GFP-HRP-TM_pLX304
Plasmid#202021Purposeexpresses GFP-HRP anchored to the extracellular side of the plasma membrane, lentiviral vectorDepositorInsertFlag-GFP-HRP-TM
UseLentiviralTagsFlag and GFPExpressionMammalianPromoterCMVAvailable SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133B2.0
Plasmid#99892PurposeGolden Gate entry vector to express the 3rd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-eGFP
Plasmid#157733Purposemammalian expression of untagged eGFP under control of a tetracycline-inducible promoterDepositorInserteGFP
ExpressionMammalianAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
T7-TetO-GFP_ColE1
Plasmid#173193PurposeExpresses GFP under the control of a T7-TetO promoter. Expression can be repressed via TetR, and repression can be relieved via addition of tetracycline. Contains the ColE1 origin of replication.DepositorInsertT7-TetO
TagsssrA degradation tag (DAS+4)ExpressionBacterialPromoterT7Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only