We narrowed to 16,945 results for: RAN-1
-
Plasmid#248101PurposeExpresses rAPOBEC1-hADAR2dd-pAG in insect cellsDepositorTagsHis and StrepExpressionInsectAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only
-
TFORF0480
Plasmid#143705PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3296
Plasmid#144772PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1945
Plasmid#143169PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
6K-loop-->R GLUT1-GFP
Plasmid#200098Purposehuman GLUT1 with K-->R mutation of 6 lysines in the major cytoplasmic loop and C-terminal GFP tag in pQCXIP vectorDepositorInsertGLUT1 (SLC2A1 Human)
UseRetroviralTagsGFPExpressionMammalianMutationK-->R mutations of amino acids 225, 229, 230, …PromoterCMVAvailable SinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
11K-cyto-->R GLUT1-GFP
Plasmid#200096Purposehuman GLUT1 with K-->R mutations for all 11 cytosolic lysines and a C-terminal GFP tag in pQCXIP vectorDepositorInsertGLUT1 (SLC2A1 Human)
UseRetroviralTagsGFPExpressionMammalianMutationK-->R mutations of amino acids 6, 7, 225, 229,…PromoterCMVAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2453 - [1-2] ENTR - Fluor - ce-mCardinal(900bp PATCs, NLS, no_atg, no_stop)
Plasmid#159863PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - ce-mCardinal(900bp PATCs, NLS, no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-IP3KC
Plasmid#134603PurposeExpresses IP3KC GFP taggedDepositorAvailable SinceNov. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-HCF-1rep1E10A
Plasmid#84607PurposePlasmid contains HCF-1rep1E10A with GST-tagDepositorAvailable SinceSept. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX-HCF-1rep1wt
Plasmid#84606PurposePlasmid contains HCF-1rep1wt with GST-tagDepositorAvailable SinceSept. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBrain-GFP-TACC3KDP(L566,567A)-shTACC3
Plasmid#69117PurposeDual-promoter plasmid to express knockdown-proof human TACC3 (L566A and L567A substitutions) tagged with EGFP along with shRNA to knock down endogenous TACC3 in mammalian cells.DepositorInsertsUseRNAiTagsEGFPExpressionMammalianMutationLL (566-567aa) mutated to AA. Silent mutations i…PromoterCMVAvailable SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRSETC-RdgBbeta-splice variant 1
Plasmid#58276Purposebacterial expression of human RdgBbeta splice variant 1DepositorAvailable SinceAug. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
TFORF0118
Plasmid#141525PurposeLentiviral vector for overexpressing the FOXM1 transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
siRNA-resistant SigmaR1-mCherry
Plasmid#226567PurposeEncodes siRNA resistant SigmaR1 protein labeled with mCherryDepositorAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLP-FRT.iGluSnFR3.v857.SGZ
Plasmid#196224PurposeFluorescent reporter for glutamate, third generation, variant 857 in SGZ backbone. iGluSnFR3.v857.SGZDepositorInsertpAAV hSyn FLP-FRT iGluSnFR3 v857.SGZ
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…TagsIgK-chain, Myc epi tag, and Stargazin and PDZ dom…ExpressionMammalianAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC25A4_STOP
Plasmid#161148PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC25A4 (SLC25A4 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCAG-rAPOBEC1-gs-XTEN-gs-hdLbCas12a(D832A)-NLS(nucleoplasmin)-gs-UGI-NLS(SV40)(LbBE1.1) (RTW1295)
Plasmid#114085PurposeCAG promoter expression plasmid for human codon optimized LbBE1.1DepositorInserthuman codon optimized DNase-inactive (D832A) LbCas12a fused to N-terminal rAPOBEC1 and C-terminal UGI (LbBE1.1)
TagsSV40 NLSExpressionMammalianMutationD832AAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-EYFP
Plasmid#103815PurposeSoluble BLInCR construct that can interact with PHR constructs upon illumination with blue lightDepositorAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
CD44v-EC-His (pcDNA3)
Plasmid#238418PurposeExpresses the polyhistidine-tagged extracellular region of CD44v (CD44v-EC-His)DepositorAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only