We narrowed to 45,642 results for: des.2

#192366

tRNA sequence provider (for checkpoint library)

Lijia Ma

Lu et al Nucleic Acids Res. 2022 Jun 24;50(11):65

Oct. 24, 2022

Academic Institutions and Nonprofits only

#133343

for constitutive expression of a single guide RNA from Streptococcus pasteurianus with a seed region that targets gcrA gene's promoter from Caulobacter crescentus

Michael Laub

Guzzo et al mBio. 2020 Jan 14;11(1):e02415-19. doi:

Jan. 22, 2020

Academic Institutions and Nonprofits only

#133345

for constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets blaA gene's promoter from Caulobacter crescentus

Michael Laub

Guzzo et al mBio. 2020 Jan 14;11(1):e02415-19. doi:

Jan. 22, 2020

Academic Institutions and Nonprofits only

#97138

overexpression of microRNA and Dendra2 in Zebrafish

Qing Deng

Hsu et al Proc Natl Acad Sci U S A. 2019 Aug 26. p

Aug. 28, 2019

Academic Institutions and Nonprofits only

#97125

overexpression of microRNA and Dendra2 in Zebrafish

Qing Deng

Hsu et al Proc Natl Acad Sci U S A. 2019 Aug 26. p

Aug. 28, 2019

Academic Institutions and Nonprofits only

#133341

for constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets gcrA gene's promoter on the template strand in Caulobacter crescentus

Michael Laub

Guzzo et al mBio. 2020 Jan 14;11(1):e02415-19. doi:

Academic Institutions and Nonprofits only

#17447

3rd gen lentiviral eGFP expression vector, CMV promoter, Neo

Eric Campeau, Paul Kaufman

Campeau et al PLoS One. 2009 Aug 6;4(8):e6529.

Aug. 12, 2009

Academic Institutions and Nonprofits only

#136059

G3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)

Anthony Leung

Fischer et al Mol Cell. 2020 Apr 2;78(1):70-84.e6. doi

Feb. 4, 2020

Academic Institutions and Nonprofits only

#136061

G3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)

Anthony Leung

Fischer et al Mol Cell. 2020 Apr 2;78(1):70-84.e6. doi

Feb. 4, 2020

Academic Institutions and Nonprofits only

#215815

Expresses N protein with HiBiT tag in mammalian cells

Thomas Gallagher

Qing et al mBio. 2021 Aug 31;12(4):e0159021. doi: 1

March 20, 2024

Academic Institutions and Nonprofits only