We narrowed to 45,642 results for: des.2
-
Plasmid#192366PurposetRNA sequence provider (for checkpoint library)DepositorInsertPro tRNA-gRNA scaffold
UseFor golden gate assemblyAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Spa)_gcrA3
Plasmid#133343Purposefor constitutive expression of a single guide RNA from Streptococcus pasteurianus with a seed region that targets gcrA gene's promoter from Caulobacter crescentusDepositorInsertsgRNA_gcrA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_blaA
Plasmid#133345Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets blaA gene's promoter from Caulobacter crescentusDepositorInsertsgRNA_blaA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
Tol2-lyzC-microRNA 338-2-Dendra2
Plasmid#97138Purposeoverexpression of microRNA and Dendra2 in ZebrafishDepositorInsertmicroRNA 338 2 Dendra2
UseZebrafishAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
Tol2-lyzC-microRNA 218a-2-Dendra2
Plasmid#97125Purposeoverexpression of microRNA and Dendra2 in ZebrafishDepositorInsertmicroRNA 218a 2 Dendra2
UseZebrafishAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_gcrA2
Plasmid#133341Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets gcrA gene's promoter on the template strand in Caulobacter crescentusDepositorInsertsgRNA_gcrA
UseCRISPRPromoterconstitutiveAvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV GFP Neo (657-2)
Plasmid#17447Purpose3rd gen lentiviral eGFP expression vector, CMV promoter, NeoDepositorInsertGFP
UseLentiviralExpressionMammalianAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-SARS-CoV-2-HiBiT-N
Plasmid#215815PurposeExpresses N protein with HiBiT tag in mammalian cellsDepositorInsertSARS-CoV-2 HiBiT Nucleocapsid (N )
ExpressionMammalianAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only