We narrowed to 43,939 results for: tro
-
Plasmid#235699PurposeControl plasmid expressing TVA and DsRed without G proteinDepositorInsertDsRedExpress, TVA800
UseRetroviralPromoterCAGAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHJ3: LexA-VHH-Control
Plasmid#108241PurposeLexA DNA binding domain fusing with anti-RNase A VHH antibodyDepositorInsertLexA DNA binding domain fusing with anti-RNase A VHH antibody
UseSynthetic BiologyPromoterpLacO1Available SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
retro-gfpIkkb-puro vector
Plasmid#58251PurposeRetroviral expression vector encoding bicistronic EGFP-IKKbeta and Puromycin cassetteDepositorAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pIG-828_HA-GD2-28z_CAR_BATF_Retroviral
Plasmid#207505PurposeThis plasmid can be used to generate retrovirus.DepositorInsertBATF, HA-GD2-28z_CAR (BATF Human)
UseRetroviralAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAJE-Ma pylRS nitroY/haloY-F5
Plasmid#225684PurposeExpresses Methanomethylophilus alvus pyrrolysine tRNA synthetase engineered for 3-nitroY and 3-haloY under GlnS promoter. Used as a control during Ma Pyl tRNA-synthetase validation.DepositorInsertsM. alvus PylRS 3-NY/HaloY F5
M. alvus Pyl-tRNA(6)
UseMethanomethylophilus alvusMutationCTG125CTT, N166A, V168S, A223C, W239RPromoterGlnS and LppAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUGW-H1-Scrambled control shRNA
Plasmid#40625DepositorInsertScrambled control shRNA
UseLentiviral and RNAiAvailable SinceOct. 4, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLY096-RetroEFS-CD22BBz-WPRE
Plasmid#192197PurposeRetro-CD22CARDepositorAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIG-831_HA-GD2-28z_CAR_TFAP4_Retroviral
Plasmid#207508PurposeThis plasmid can be used to generate retrovirus.DepositorInsertTFAP4, HA-GD2-28z_CAR (TFAP4 Human)
UseRetroviralAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-flex-Voltron
Plasmid#119035PurposeCre-dependant expression of Voltron in neuronsDepositorInsertVoltron
UseAAVExpressionMammalianPromoterhsynAvailable SinceDec. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-TRE3G-IRSp53 S269D
Plasmid#221319PurposeDox-inducible expression of IRSp53 mutant in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2259 - Intron GG2 - 900 bp
Plasmid#159881PurposeGolden Gate compatible intron with PATCs for reduced germline silencingDepositorInsertIntron GG2 - 900 bp
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBABE zeo Ecotropic Receptor
Plasmid#10687DepositorAvailable SinceDec. 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2215 - Intron GG3 - 900 bp
Plasmid#159882PurposeGolden Gate compatible intron with PATCs for reduced germline silencingDepositorInsertIntron GG3 - 900 bp
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2214 - Intron GG1 - 900 bp
Plasmid#159880PurposeGolden Gate compatible intron with PATCs for reduced germline silencingDepositorInsertIntron GG1 - 900 bp
ExpressionWormMutationNot applicableAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Control-PTEN-3'UTR-Wt
Plasmid#21326DepositorAvailable SinceJune 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-flex-Positron-ST
Plasmid#129267PurposeCre-dependant expression of soma-localized Positron in neuronsDepositorInsertPositron-ST
UseAAVExpressionMammalianMutationD92N, E199VPromoterhsynAvailable SinceOct. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-Tight_A-CREB_PGK-tdTomato
Plasmid#154264PurposeDox/Tet-inducible expression of dominant negative CREB (A-CREB) in mammalian cells.DepositorInsertdominant negative CREB
ExpressionMammalianPromoterTight/tetOAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS416-PTEF1-MCP-no_intron
Plasmid#127597Purposelow-copy URA-selectable plasmid, 1xFLAG-MCP under TEF1 promoterDepositorInsert1xFLAG-MCP expression cassette
ExpressionYeastAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-flex-Voltron-ST
Plasmid#119036PurposeCre-dependant expression of soma-localized Voltron in neuronsDepositorHas ServiceAAV1InsertVoltron-ST
UseAAV and Cre/LoxExpressionMammalianPromoterhsynAvailable SinceDec. 19, 2018AvailabilityAcademic Institutions and Nonprofits only