We narrowed to 28,194 results for: sta
-
Plasmid#23772DepositorInsertNME5 (NME5 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pRCA378 - pBA904 Puro-T2A-GFP CD45 CRISPRa guide 3 (pRCA360 backbone)
Plasmid#238169PurposeLentiviral CRISPR guide vector expressing PTPRC targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
18065-M04-412
Plasmid#225667PurposeLentivirus protein expression. Control plasmid.DepositorInsertsUseLentiviralTags3xFLAGMutationC-terminally truncated (aa 1-333 only)PromoterWPRE-SV40p and mCMVpAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTT3-ecdCD80-ST3-His
Plasmid#210665PurposeExpression of the extracellular domain of human CD80 fused to Spytag003 + Histag in HEK293 (or similar)DepositorInsertExtracellular domain of human CD80 fused to Spytag003 and Histag (CD80 Human)
TagsHistag and Spytag003ExpressionMammalianPromoterCMVAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO shLYCHOS/LYCHOS WT-FLAG
Plasmid#209315PurposeLentiviral construct expressing shRNA against LYCHOS and LYCHOS WT-FLAG (resistant to shRNA)DepositorAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-EGFL7-COMP5AP-AviTag-9xHis
Plasmid#157266PurposeMammalian expression of secreted protein fused to COMP5AP-AviTag-9xHis.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGK-Ldb3-mKate2
Plasmid#128766PurposeFluorescent mKate reporter for Ldb3DepositorAvailable SinceNov. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-GUCY2C-G549C
Plasmid#116407PurposeLentiviral expression of GUCY2C G549CDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) TSPAN9
Plasmid#107502PurposeExpresses TSPAN9, puromycin resistantDepositorAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-chimeric-IgM-mouse/human_M18
Plasmid#91738PurposeExpression plasmid coding for modified heavy chain of mouse IgM antibody. Residues 203-239 (EU numbering) were exchanged to human homologue sequence.DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationResidues 203-239 (EU numbering) were exchanged to…PromoterhEF1-HTLV promAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mM-Asp212Ser_M18
Plasmid#91739PurposeExpression plasmid coding for mutated heavy chain of mouse IgM antibody specific to antigen B of the ABO blood group system, clone M18. Mutation: Asp212Ser (EU numbering) - N-glycosylated Asn209DepositorInsertimmunoglobulin heavy constant mu (Ighm Mouse)
ExpressionMammalianMutationAsp212 changed to Ser (EU numbering)PromoterhEF1-HTLV promAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-LOC442075
Plasmid#23372DepositorInsertLOC442075 (LOC442075 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
His6-TEV-CRBN-midi
Plasmid#215330PurposeCRBN midi construct for use in crystallography and biophysical studies enabling ligand and degrader designDepositorInsertCRBN (CRBN Human)
Tags6xHis and TEVExpressionBacterialMutationcontains amino acids 41-187 followed by a Gly-Ser…PromoterlacIAvailable SinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHIV-NAT-FLAG-CIP2A FL (sg2R)
Plasmid#222624PurposeLentiviral vector that expresses Flag-tagged sgRNA resistant CIP2A in mammalian cellsDepositorInsertCIP2A (CIP2A Human)
UseLentiviralTagsFlagExpressionMammalianPromoterEF-1-alpha promoterAvailable SinceJuly 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
18065-M01-412
Plasmid#225664PurposeLentiviral expression of FLAG-tagged fluorescent proteins for immunohistochemical detection in FFPE tissueDepositorInsertsUseLentiviralTags3xFLAGMutationC-terminally truncated (aa 1-333 only)PromoterSORE6-mCMVp and WPRE-SV40pAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX_307-SOD1WT
Plasmid#83444PurposeMammalian expression of SOD1WTDepositorAvailable SinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3-human OCT4 DE-SV40-Luc
Plasmid#52414PurposeLuciferase reporter plasmid for DE OCT4 enhancer activityDepositorAvailable SinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only