We narrowed to 13,644 results for: Mpl
-
Plasmid#115828PurposeEncodes codon optimized 3xFLAG-SIVAGM Vpr (MAL_ZMB) (LC114462) and puromycin resistance proteinDepositorInsertSIVAGM Vpr (MAL_ZMB) (LC114462)
UseLentiviralTags3x-FLAGPromoterSFFVAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pscALPS-SIV-ASC vpr
Plasmid#115824PurposeEncodes codon optimized 3xFLAG-SIVASC Vpr (KJ461715) and puromycin resistance proteinDepositorInsertSIVASC Vpr (KJ461715)
UseLentiviralTags3x-FLAGPromoterSFFVAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pscALPS-SIV-DEB vpr
Plasmid#115823PurposeEncodes codon optimized 3xFLAG-SIVDEB Vpr (FJ919724) and puromycin resistance proteinDepositorInsertSIVDEB Vpr (FJ919724)
UseLentiviralTags3x-FLAGPromoterSFFVAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pscALPS-SIV-LST vpr
Plasmid#115818PurposeEncodes codon optimized 3xFLAG-SIVLST Vpr (AF188116) and puromycin resistance proteinDepositorInsertSIVLST Vpr (AF188116)
UseLentiviralTags3x-FLAGPromoterSFFVAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pscALPS-SIV-MND1 vpr
Plasmid#115817PurposeEncodes codon optimized 3xFLAG-SIVMND1 Vpr (M27470) and puromycin resistance proteinDepositorInsertSIVMND1 Vpr (M27470)
UseLentiviralTags3x-FLAGPromoterSFFVAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158) in pcDNAI/Amp
Plasmid#60888PurposeThis vector attaches YFP(1-158) to the N-terminus of a protein.DepositorInsertYFP(1-158)
ExpressionMammalianMutationMet was substituted for Gln-69.PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2210 - [1-2] ENTR - Fluor - mMaple3(1 intron, syntrons(3), no_start, no_stop)
Plasmid#159864PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - mMaple3(1 intron, syntrons(3), no_start, no_stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmCup_C
Plasmid#146041PurposeInsect Expression of DmCupDepositorAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-hRIP3-FL V460P
Plasmid#61379PurposeExpresses Human full length RIPK3 with V460P mutation in the mammalian cellsDepositorInsertFull length human RIP3 with V460Pmutation (RIPK3 Human)
TagsEYFPExpressionMammalianMutationchanged V460 to PAvailable SinceJan. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-hRIP3-FL V458P
Plasmid#61377PurposeExpresses Human full length RIPK3 with V458P mutation in the mammalian cellsDepositorInsertFull length human RIP3 with V458Pmutation (RIPK3 Human)
TagsEYFPExpressionMammalianMutationchanged V458 to PAvailable SinceJan. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-myc-mCE(K294A)
Plasmid#82461PurposeExpression of myc epitope and catalytic inactive form of murine mRNA Capping Enzyme (K294A) in mammalian cellsDepositorInsertmCE (K294A) (Rngtt Mouse)
TagsmycExpressionMammalianMutationLysine 294 changed to AlaninePromoterCMVAvailable SinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
As3 (pBW411J117-arsR)
Plasmid#123142PurposeAn arsenic sensor with optimized intracellular receptor density. Also used in the sensor cell array. pSB3K3 carrying J117-30arsR-t-ParsR-30gfp-tDepositorInsertJ117-30arsR-t-ParsR-30gfp-t
UseSynthetic BiologyExpressionBacterialPromoterJ117, ParsRAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBacPAK8-His-myc-Uba1
Plasmid#29508DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEXP5-NT-CuSeCat
Plasmid#42568DepositorInsertmutated calmodulin gene
TagsPolyhistidine (6×His) region, TEV recognition sit…ExpressionBacterialMutationchanged Phenylalanine 92 to Glutamine acid, Valin…PromoterT7Available SinceMarch 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMDJ16 - pEXP[Peft-3 | mMaple3 (NLS) | tbb-2 UTR]
Plasmid#159802PurposeExpression construct with ubiquitous expression to test fluorescence level on microscopeDepositorInsertpEXP[Peft-3 | mMaple3 (NLS) | tbb-2 UTR]
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVH028
Plasmid#80393PurposeContains constitutive histidine kinase (pCon-Taz) with 4x SH3 scaffold domains + salicylate inducible phosphatase (Psal-CusSmut)DepositorUseSynthetic BiologyTagsFused by GS linkers to 4 SH3 domainsExpressionBacterialMutationGlycine 448 changed to Alanine, makes it primaril…Available SinceNov. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1X-Nup88-mut
Plasmid#87337PurposeTo express human Nup88 in mammalian cells. It contains synonymous mutations that are not targeted by shRNADepositorInsertNUP88 (NUP88 Human)
TagsEGFPExpressionMammalianMutationshRNA resistant changesPromoterCMVAvailable SinceMay 4, 2017AvailabilityAcademic Institutions and Nonprofits only