We narrowed to 7,014 results for: tac
-
Plasmid#91189PurposeBeYDV replicon T-DNA for gene targeting in tobacco leaves, D10A double nickase (nAtCas9_D10A+gNt_R2+gNt_F2+donor)DepositorInsertnAtCas9_D10A+gNt_R2+gNt_F2+donor
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAT9751-BEAR-mCherry-preedited
Plasmid#162993PurposeBEAR control plasmid with split mCherry and intact 5' splice siteDepositorInsertmCherry split with an intron between amino acids 119-120
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
PAX6 sgRNA7
Plasmid#68466Purposetargeting PAX6 geneDepositorAvailable SinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti-SLC35B2-sgRNA
Plasmid#154860PurposeLentiviral expression of Cas9 and sgRNA targeting SLC35B2DepositorAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
psicheck-2-Casp8
Plasmid#48172Purposecontains Renilla Luciferase gene preceded by an intact (ATG) upstream open reading frame elementDepositorInsert5" UTR of CASP8 (CASP8 Human)
UseLuciferaseAvailable SinceOct. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
U6_ ATM_G101_sgRNA_CAG_St1Cas9_CNRZ1066_v2
Plasmid#214814PurposeA single vector containing a CAG-driven Cas9 variant from S. thermophilus recognizing a consensus NNACAA PAM (St1Cas9 CNRZ1066 v2) and its U6-driven sgRNA targeting human ATMDepositorAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEA02
Plasmid#172193PurposeSuicide vector carrying the site attL of the SSR system of pSAM2. This plasmid is integrated into the genome of Actinobacteria by HR when carrying a DNA fragment identical to a region of the genome.DepositorInsertattL
ExpressionBacterialAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEA03
Plasmid#172194PurposeSuicide vector carrying the site attR of the SSR system of pSAM2. This plasmid is integrated into the genome of Actinobacteria by HR when carrying a DNA fragment identical to a region of the genome.DepositorInsertattR
ExpressionBacterialAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
CEP55 B12.2 gRNA
Plasmid#90623Purpose3rd generation lentiviral gRNA plasmid targeting human CEP55DepositorInsertCEP55 (Guide Designation B12.2)
UseCRISPR and LentiviralPromoterU6Available SinceNov. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
POT1 E3.4 gRNA
Plasmid#90842Purpose3rd generation lentiviral gRNA plasmid targeting human POT1DepositorInsertPOT1 (Guide Designation E3.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-mas-KB-1753-Nluc I9A/W10A
Plasmid#158604PurposePlasmid expressing KB-1753-Nluc I9A/W10A in mammalian cellsDepositorInsertmyristic acid attachment peptide (mas; MGSSKSKTSNS) - linker(GIKLGG) - KB1753 I9A/W10A - linker (GGTGGS) - Nluc
ExpressionMammalianPromoterCMVAvailable SinceJune 29, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1-mas-GRK2RH-Nluc L118A
Plasmid#158606PurposePlasmid expressing GRK2(RH)-Nluc L118A in mammalian cellsDepositorInsertmyristic acid attachment peptide (mas; MGSSKSKTSNS) - linker (GIKLGG) - GRK2 RH domain L118A - linker (GGTGGS) - Nluc
ExpressionMammalianPromoterCMVAvailable SinceJune 29, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
KIF11 F5.3 gRNA
Plasmid#90716Purpose3rd generation lentiviral gRNA plasmid targeting human KIF11DepositorInsertKIF11 (Guide Designation F5.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX458-sgRNA_Ago2_4
Plasmid#73532PurposeExpresses SpCas9, GFP, and sgRNA targeting Ago2DepositorInsertAGO2
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
shNg Lenti FHRC3J1UGW
Plasmid#92233Purposelentiviral expression of EGFP and Ng shRNADepositorInsertshRNA targeting Ng
UseLentiviralExpressionMammalianPromoterH1Available SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nelfcd-g2)-PGKpuroBFP-W
Plasmid#105026PurposeLentiviral gRNA plasmid targeting mouse Nelfcd , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLJM60-S6K1(T389S) barcoded
Plasmid#48800Purposeexpresses mutant S6K1DepositorInsertS6K1 T389S (Rps6kb1 Rat)
UseLentiviralTagsFLAG and barcode: GGTACCExpressionMammalianMutationT389SPromoterCMVAvailable SinceDec. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
TOP2A G11.2 gRNA
Plasmid#90914Purpose3rd generation lentiviral gRNA plasmid targeting human TOP2ADepositorInsertTOP2A (Guide Designation G11.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
shCTL-mlpx-puro
Plasmid#65232Purposeencodes a non-targeting control shRNADepositorInsertnon-coding shRNA
ExpressionMammalianPromoterPGKAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only