We narrowed to 35,042 results for: CAT

#76141

3rd generation lentiviral gRNA plasmid targeting human TRIM28

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#74049

retroviral expression plasmid for human NFATc1/bC

Ria Baumgrass

Gabriel et al J Biol Chem. 2016 Sep 16. pii: jbc.M116.

June 8, 2016

Academic Institutions and Nonprofits only

#58731

expression of HA tagged mouse Alpha2 delta-2 in mamalian cells

Annette Dolphin

Davies et al J Neurosci. 2006 Aug 23;26(34):8748-57.

Sept. 10, 2014

Academic Institutions and Nonprofits only

#76415

3rd generation lentiviral gRNA plasmid targeting human PIK3C2A

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#80071

Expression of a sumo-mutant form GFP-BLM with K317R and K331R sumo-site mutations

Nathan Ellis

Eladad et al Hum Mol Genet. 2005 May 15;14(10):1351-6

July 25, 2016

Academic Institutions and Nonprofits only

#71216

dCas9 fused to human DNMT3A catalytic domain

Yonglun Luo

Lin et al Gigascience. 2018 Mar 1;7(3):1-19. doi:

June 20, 2018

Academic Institutions and Nonprofits only

#87404

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#82501

Expresses GFP with 3 UAG codons at the amino acid position 3, 151, and 153

Chang Liu

Schwessinger et al Integr Biol (Camb). 2016 Apr 18;8(4):542

Sept. 22, 2016

Academic Institutions and Nonprofits only

#58851

AAV-mediated expression of ArchT-GFP under the EF1a promoter, in floxed/reversed (Cre-dependent) manner

Edward Boyden

Han et al Front Syst Neurosci. 2011;5:18. Epub 201

Aug. 14, 2014

Academic Institutions and Nonprofits only

#75497

3rd generation lentiviral gRNA plasmid targeting human RPS6KA1

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#71217

dCas9 fused to human DNMT3B catalytic domain

Yonglun Luo

Lin et al Gigascience. 2018 Mar 1;7(3):1-19. doi:

June 20, 2018

Academic Institutions and Nonprofits only

#67863

bacterial expression of SDR5C1 (HSD17B10), full coding sequence + N-term. His tag (thrombin site)

Walter Rossmanith

Holzmann et al Cell. 2008 Oct 31;135(3):462-74. doi: 10

Aug. 14, 2015

Academic Institutions and Nonprofits only

#74975

shETV4 shRNA

William Hahn

Wang et al Cell Rep. 2017 Feb 7;18(6):1543-1557. do

May 10, 2017

Academic Institutions and Nonprofits only

#73073

human E2F7 minigene (exons 11,12,13/introns cassette)

Stefan Stamm

Falaleeva et al Proc Natl Acad Sci U S A. 2016 Mar 22;11

Dec. 7, 2018

Academic Institutions and Nonprofits only