We narrowed to 14,335 results for: cas9
-
Plasmid#140582PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA TTLL11
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
p458 VRER
Plasmid#101728PurposeExpresses a sgRNA and a Cas9 VRER variant that recognizes "NGCG" PAM motifsDepositorInsertSpCas9 VRER
Tags3xFLAG-NLS and NLSExpressionMammalianMutationVRER (D1135V, G1218R, R1335E, and T1337R mutation…Available SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
Hulk-ubi-lacZ-to-Green
Plasmid#108641Purposeubiquitous promoter followed by a lacZ to GFP lineage tracing line. Cryst:venusGFPDepositorInsertubi-lacZ-to-GFP
Available SinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
p330 VQR
Plasmid#101730PurposeExpresses a sgRNA and a Cas9 VQR variant that recognizes "NGA" PAM motifsDepositorInsertSpCas9 VQR
Tags3xFLAG-NLS and NLSExpressionMammalianMutationVQR (D1135V, R1335Q, and T1337R mutations in Cas9)Available SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB8381
Plasmid#126915PurposePlasmid containing integration cassette at XI-3 integration site in Saccharomyces cerevisiae for overexpression of XdCrtI and tHMG1DepositorInsertXdCrtI and tHMG1
ExpressionYeastAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
peft-3::cas-9::tbb-2 3'UTR
Plasmid#48960Purposethis plasmid contains the codon optimized gene encoding Cas9 for C. elegans.DepositorInsertcas9
UseCRISPRPromotereef-1A.1 (eft-3)Available SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-HEK3+24
Plasmid#140577PurposeExpresses a pegRNA in mammalian cellsDepositorInsertpegRNA HEK3 +24
Available SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCR1003
Plasmid#71821PurposeExpress Streptococcus pyogenes dCas9 (D10A, H840A)DepositorInsertT7pr_10xHis-MBP-TEV-SPydCas9 (D10A, H840A)
UseCRISPRAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOsU3-esgRNA
Plasmid#115629Purposeexpression esgRNA in rice protoplastsDepositorInsertOsU3p-esgRNA
UseCRISPRAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-CLIC3
Plasmid#140583PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA CLIC3
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
BCJJ339
Plasmid#117501PurposeRPS5a:Cas9:E9 Golden Gate Level 1 Position 2DepositorInsertBpiI:GCAA:RPS5a:Cas9-3(intron):E9:ACTA:BpiI
UseCRISPRExpressionPlantPromoterAtRPS5aAvailable SinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19, containing H2-Kb c57/BL6 WK9
Plasmid#102641PurposeEncodes sequence of the murine H2-Kb alleleDepositorInsertH2-Kd Balb/c
Available SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNeurog2-Luciferase reporter
Plasmid#64126PurposePhotoactivatable transcription system. Luciferase reporter under the control of the Neurog2 promoter.DepositorInsertNeurog2 promoter
UseLuciferaseTagsluciferaseExpressionMammalianPromoterNeurog2Available SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP582-2
Plasmid#70049PurposeExpresses Ollas::mCherry::linker::H2B::V5 in bacteriaDepositorInsertmCherry::linker::H2B
TagsOllas and V5ExpressionBacterialAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TB
Plasmid#48650PurposeBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCfB8792
Plasmid#126910PurposeTemplate for PCR amplification of ADE2 gRNA biobrick for targeting Saccharomyces cerevisiae ADE2 geneDepositorInsertADE2 gRNA
UseSynthetic BiologyAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJin-278
Plasmid#125714PurposeABA-inducible split T7 GFP vector using RNAPN d5-19DepositorInsertPT7-GFP mRNA expression, PYL-linker-T7 RNAPC, T7 RNAPN (d5-19)-linker-ABI
ExpressionMammalianAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCR1055
Plasmid#71823PurposeExpress Streptococcus pyogenes nCas9 (H840A) nickase carrying two C-terminal SV40 NLSDepositorInsertT7pr_6xHis-MBP-TEV-SPynCas9 (H840A)-2xNLS
UseCRISPRAvailable SinceFeb. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-EMX1
Plasmid#140581PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA EMX1
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJA50
Plasmid#59931PurposegRNA for cleavage at unc-58(e665) locus in C elegansDepositorInsertunc-58(e665) gRNA
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only