We narrowed to 18,003 results for: Uty
-
Plasmid#124154PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pBABE (hygro) hYAP 1-1alpha
Plasmid#124147PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1beta
Plasmid#124148PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1gamma
Plasmid#124149PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2alpha
Plasmid#124151PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2beta
Plasmid#124152PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2gamma
Plasmid#124153PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 (-) hYAP 1-1beta
Plasmid#124140PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG3_VPEVS
Plasmid#105863PurposeExpression plasmid coding for mutated heavy chain of mouse IgG3 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody has mutated 5 amino acids in lower hinge.DepositorInsertIgG3 heavy chain (Ighg3 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG3 with five mutat…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_ILGGP
Plasmid#105855PurposeExpression plasmid coding for mutated heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody has mutated 5 amino acids in lower hinge.DepositorInsertIgG1 heavy chain (Ighg1 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG1 with five mutat…PromoterhEF1-HTLV promAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUSEss-CHIg-mG1_CH2charge
Plasmid#105852PurposeExpression plasmid coding for mutated heavy chain of mouse IgG1 antibody specific to antigen B of the ABO blood group system, clone M18. Introduced mutations modify charge of CH2 domain.DepositorInsertIgG1 heavy chain (Ighg1 Mouse)
ExpressionMammalianMutationmutated heavy chain of mouse IgG1, muatations: Gl…PromoterhEF1-HTLV promAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno BN
Plasmid#101823PurposeAdenovirus for the expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1DepositorUseAdenoviralTagsFLAG-Cas9Available SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMCh-1538
Plasmid#82431PurposePlasmid for expression of NHA-tagged human-Nematostella GW182 11W11A chimera in mammalian cellsDepositorInserths-nvGW182 11W11A chimera
TagsNHAExpressionMammalianMutationaa 1-1169 of siRNA resistant hsTNRC6A (Q8NDV7-2) …PromoterCMVAvailable SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
Progerin-S22D-CS-pLPC
Plasmid#73810PurposeProgerin mutant where Serine 22 is mutated to aspartic acid and where there is a substitution of cysteine in CaaX-motif by a serineDepositorInsertProgerin (LMNA Human)
UseRetroviralExpressionMammalianMutationProgerin with substitution of cysteine in CaaX-mo…PromoterCMVAvailable SinceApril 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLPC-S22AProgerin-CS
Plasmid#69063Purposeencodes a Progerin mutant with serine 22 mutated to an alanine and with a substitution of cysteine in CaaX-motif by a serineDepositorInsertProgerin (LMNA Human)
UseRetroviralExpressionMammalianMutationProgerin with serine 22 mutated to alanine and wi…PromoterCMVAvailable SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
tdEos-EB3-7
Plasmid#57610PurposeLocalization: MT End Binding Protein, Excitation: 505 / 569, Emission: 516 / 581DepositorAvailable SinceJan. 16, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
GFP-itis Bacterial Base Editor Activity
Plasmid Kit#1000000219PurposeThis collection contains all plasmids needed for preparation and execution of the "GFP-itis" bacterial base editing activity.DepositorAvailable SinceMay 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE6b
Plasmid#207852PurposeMammalian expression of PE6b prime editorDepositorInsertPE6b
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationTf1rt(P70T, G72V, S87G, M102I, K106R, K118R, I128…Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only