We narrowed to 4,533 results for: Gaa
-
Plasmid#183133PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii dsx, Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[dsx]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_YES1
Plasmid#183329PurposeAll-in-One CRISPRko system with a guide RNA that targets YES1 geneDepositorInsertYES1
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_MAP2K1
Plasmid#183308PurposeAll-in-One CRISPRko system with a guide RNA that targets MAP2K1 geneDepositorInsertMAP2K1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_ALK
Plasmid#183270PurposeAll-in-One CRISPRko system with a guide RNA that targets ALK geneDepositorInsertALK
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB6637
Plasmid#106164PurposeEasyCloneYALI system-based yeast gRNA expression vector carrying a nourseothricin-resistance marker, helps to integrate vector pCfB6681 into Yarrowia lipolytica chromosomal location IntE_3, amp resistanceDepositorInsertunknown
ExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
LEP-shTADA1.1580
Plasmid#105568Purposeretrovirally express TADA1 shRNA with puro resistance and GFP markerDepositorInsertTADA1 shRNA
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
LEP-shTADA1.1226
Plasmid#105567Purposeretrovirally express TADA1 shRNA with puro resistance and GFP markerDepositorInsertTADA1 shRNA
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
MLSE-shRPA3.457
Plasmid#105584Purposeretrovirally express RPA3 shRNA with GFP markerDepositorInsertRPA3 shRNA #457
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
LEP-shTAF2.1635
Plasmid#105561Purposeretrovirally express TAF2 shRNA with puro resistance and GFP markerDepositorInsertTAF2 shRNA
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCRRNA-G14-R0
Plasmid#101806PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_NCoA2_1
Plasmid#86341PurposeEncodes gRNA for 3' target of human NCoA2DepositorInsertgRNA against NCoA2 (NCOA2 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A5T
Plasmid#62264Purposeexpression of A5T sgRNA from the arabinose-inducible promoterDepositorInsertA5T sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A5NT
Plasmid#62263Purposeexpression of A5NT sgRNA from the arabinose-inducible promoterDepositorInsertA5NT sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A4T
Plasmid#62262Purposeexpression of A4T sgRNA from the arabinose-inducible promoterDepositorInsertA4T sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A1NT
Plasmid#62255Purposeexpression of A1NT sgRNA from the arabinose-inducible promoterDepositorInsertA1NT
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-3'UTR
Plasmid#136038PurposeG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCfB6364
Plasmid#106151PurposeEasyCloneYALI system-based yeast integrative vector expressing Cas9 carrying D-serine marker, integration into Yarrowia lipolytica ku70 locus, amp resistanceDepositorInsertCas9
ExpressionYeastAvailable SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
L1_lacZgRNA-Ck3
Plasmid#136136PurposeL1 in position 3, to clone gRNA target using BbsI, lacZ blue-white screeningDepositorInsertp5-MpU6:lacZgRNA
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-LK03
Plasmid#206512PurposeAAV packaging vector containing AAV2 rep and LK03 cap and partial AAV2 p5 promoterDepositorInsertLK03 capsid
UseAAVPromoterp5Available SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJYS3_ΔcrtYf
Plasmid#85542PurposeConstitutive transcription of FnCpf1 and crRNA of crtYfDepositorInsertsCpf1
crRNA of crtYf
UseCRISPR; Shuttle vector corynebacterium glutamicum…ExpressionBacterialAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1373_mU6_sgRNA targeting e1
Plasmid#190684PurposesgRNA targeting enhancer 1 of MYCDepositorInsertsgRNA targeting enhancer 1 of MYC
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianPromotermouse U6 promoterAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
L1_lacZgRNA-Ck2
Plasmid#136137PurposeL1 in position 2, to clone gRNA target using BbsI, lacZ blue-white screeningDepositorInsertp5-MpU6:lacZgRNA
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-CDS
Plasmid#136039PurposeG3BP1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGGGAATTTGTGAGACAGTAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pA-Opto
Plasmid#253255PurposeOpto-CheY expressed using the proA promoter and T7 RBS variant GAAGGAGgTDepositorInsertOpto-CheY
ExpressionBacterialMutationT7 RBS variant GAAGGAGgTAvailable SinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
p5g-Opto_N449S
Plasmid#253285PurposeOpto-CheY N449S expressed using the pro5 promoter and T7 RBS variant GAAGGAGgTDepositorInsertOpto-CheY with N449S mutation
TagsT7 RBS variant GAAGGAGgTExpressionBacterialAvailable SinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pA-Opto_N449S
Plasmid#253256PurposeOpto-CheY N449S expressed using the proA promoter and T7 RBS variant GAAGGAGgTDepositorInsertOpto-CheY with N449S mutation
TagsT7 RBS variant GAAGGAGgTExpressionBacterialAvailable SinceMarch 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pA-Opto_V416T
Plasmid#253257PurposeOpto-CheY V416T expressed using the proA promoter and T7 RBS variant GAAGGAGgTDepositorInsertOpto-CheY with V416T mutation
ExpressionBacterialMutationT7 RBS variant GAAGGAGgTAvailable SinceMarch 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
dSaCas9-VPR
Plasmid#205251PurposeIn vitro transcription plasmid for production of dSaCas9-VPR mRNA for transcriptional activation (VPR = tripartite transactivator VP64, p65, and Rta). Insert is derived from Addgene plasmid #68495DepositorInsertdSaCas9-VPR
UseCRISPRAvailable SinceSept. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
dSpCas9-VPR
Plasmid#205247PurposeIn vitro transcription plasmid for production of dSpCas9-VPR mRNA for transcriptional activation (VPR = tripartite transactivator VP64, p65, and Rta). Insert is derived from Addgene plasmid #63798.DepositorInsertdSpCas9-VPR
UseCRISPRAvailable SinceSept. 20, 2023AvailabilityAcademic Institutions and Nonprofits only